Incidental Mutation 'R4731:Ulk4'
ID 358852
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 042021-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R4731 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120955351-121277197 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 121263638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 178 (R178*)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051479
AA Change: R178*
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably null
Transcript: ENSMUST00000171061
AA Change: R178*
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
AA Change: R178*
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: R178*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Akap9 T A 5: 3,962,266 S990T possibly damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Anxa2 A T 9: 69,486,530 M217L probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
Btaf1 A G 19: 36,981,078 D665G probably benign Het
Ccdc36 A G 9: 108,405,385 V368A probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cfap74 T A 4: 155,463,602 probably benign Het
Chd1 A T 17: 17,377,817 E55D probably benign Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec9a G T 6: 129,416,336 A108S probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col9a3 G A 2: 180,610,681 E373K probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Ercc4 A T 16: 13,147,607 H701L probably damaging Het
Ern1 A T 11: 106,434,850 probably benign Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Evc T A 5: 37,323,797 M235L probably benign Het
Fbxw22 T C 9: 109,378,869 I445V probably benign Het
Fmnl2 A G 2: 53,117,069 T764A possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr83 A G 9: 14,866,174 probably benign Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Helb T C 10: 120,094,288 probably null Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igdcc3 A G 9: 65,181,997 T492A probably damaging Het
Ighv13-1 T C 12: 114,267,632 probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Llgl1 T A 11: 60,706,225 L194* probably null Het
Map3k12 G T 15: 102,501,282 T686N probably benign Het
Myo18a C A 11: 77,829,759 P741Q probably benign Het
Ncaph2 G A 15: 89,355,827 probably benign Het
Nfkb2 A G 19: 46,308,964 Q406R possibly damaging Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr874 A T 9: 37,746,535 T134S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Ostm1 C T 10: 42,678,979 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Phc2 C T 4: 128,707,971 T73M probably damaging Het
Pkp4 G A 2: 59,334,932 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Plk5 A T 10: 80,358,797 H118L probably damaging Het
Pnlip T C 19: 58,676,487 I249T probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprb T C 10: 116,319,333 V664A probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Ros1 A C 10: 52,142,229 W778G probably damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Samd4b G A 7: 28,406,663 R377W probably benign Het
Selenoo A G 15: 89,099,328 Q524R probably benign Het
Slc30a3 T C 5: 31,093,294 S22G probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc5a8 T C 10: 88,925,787 probably null Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slfn1 A T 11: 83,121,835 E259V probably damaging Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Sptbn2 T A 19: 4,742,480 F1388I probably damaging Het
Stac2 C T 11: 98,039,695 G349E probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trank1 T C 9: 111,390,410 F2072L probably damaging Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Trpc7 A G 13: 56,804,553 S541P probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Tspoap1 T A 11: 87,765,647 V257E probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ubr7 A G 12: 102,769,226 T315A probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Utp20 T C 10: 88,754,520 D2364G possibly damaging Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zfhx3 A G 8: 108,956,084 Q3385R unknown Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp738 A T 13: 67,669,914 C653S probably damaging Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
R8841:Ulk4 UTSW 9 121204738 missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121188228 missense probably benign 0.00
R9092:Ulk4 UTSW 9 121073937 missense
R9126:Ulk4 UTSW 9 121261922 missense probably damaging 0.99
R9176:Ulk4 UTSW 9 121145062 missense probably benign
R9235:Ulk4 UTSW 9 121152151 missense probably benign 0.13
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATTGTCCAAGACC -3'
(R):5'- CTGAGCCGTGACAGAACAAG -3'

Sequencing Primer
(F):5'- CAAGACCTCTTGTGCTGACAC -3'
(R):5'- CCCTGTGAGGCCTGAATTG -3'
Posted On 2015-11-11