Mutagenetix > Incidental Mutation

Incidental Mutation 'R4731:Ryr2'

358874

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

042021-MU

Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4731 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11577909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 4653 (M4653K)

Ref Sequence

ENSEMBL: ENSMUSP00000127991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021750
AA Change: M4653K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: M4653K

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170156
AA Change: M4653K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: M4653K

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222113

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222788

Meta Mutation Damage Score

0.0991

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

99% (117/118)

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts12	A	T	15: 11,270,662	S668C	probably damaging	Het
Adcy8	A	G	15: 64,754,862	V709A	possibly damaging	Het
AI413582	A	G	17: 27,565,270		probably benign	Het
Aim2	T	A	1: 173,463,876	D282E	possibly damaging	Het
Akap9	T	A	5: 3,962,266	S990T	possibly damaging	Het
Aloxe3	A	T	11: 69,128,654	D131V	probably null	Het
Ankrd28	A	C	14: 31,755,741	C115G	probably benign	Het
Anxa2	A	T	9: 69,486,530	M217L	probably benign	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
BC024978	T	A	7: 27,201,043	M149K	probably damaging	Het
Btaf1	A	G	19: 36,981,078	D665G	probably benign	Het
Ccdc36	A	G	9: 108,405,385	V368A	probably benign	Het
Cdc42bpg	T	A	19: 6,311,191	V282E	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdipt	T	A	7: 126,978,358	L92H	probably damaging	Het
Cep104	T	A	4: 153,988,426	D380E	probably damaging	Het
Cfap74	T	A	4: 155,463,602		probably benign	Het
Chd1	A	T	17: 17,377,817	E55D	probably benign	Het
Cldnd2	T	A	7: 43,442,189	C65S	possibly damaging	Het
Clec9a	G	T	6: 129,416,336	A108S	probably benign	Het
Cog7	T	C	7: 121,964,244	D215G	probably benign	Het
Col9a3	G	A	2: 180,610,681	E373K	probably damaging	Het
Deptor	C	A	15: 55,181,010	H191N	probably benign	Het
Dgkz	A	T	2: 91,938,339	I699N	probably damaging	Het
Dnah7c	T	A	1: 46,770,173	N3550K	probably damaging	Het
Dnah8	A	G	17: 30,775,061	K3384R	probably null	Het
Dnajc13	CT	C	9: 104,186,805		probably benign	Het
Dnhd1	C	A	7: 105,673,849	N521K	probably benign	Het
Efhb	G	A	17: 53,426,244	T533I	probably damaging	Het
Ercc4	A	T	16: 13,147,607	H701L	probably damaging	Het
Ern1	A	T	11: 106,434,850		probably benign	Het
Etfb	T	C	7: 43,444,200	V17A	probably damaging	Het
Evc	T	A	5: 37,323,797	M235L	probably benign	Het
Fbxw22	T	C	9: 109,378,869	I445V	probably benign	Het
Fmnl2	A	G	2: 53,117,069	T764A	possibly damaging	Het
Fto	T	A	8: 91,409,714	D205E	probably damaging	Het
Galntl6	G	A	8: 58,427,813	P147L	probably damaging	Het
Gm6871	T	C	7: 41,546,749	I39V	probably benign	Het
Gpr83	A	G	9: 14,866,174		probably benign	Het
Gucy1a2	A	T	9: 3,759,424	H410L	probably benign	Het
Helb	T	C	10: 120,094,288		probably null	Het
Ifi214	T	C	1: 173,526,591	Q171R	probably benign	Het
Ifit1bl1	T	C	19: 34,594,321	I245M	probably benign	Het
Igdcc3	A	G	9: 65,181,997	T492A	probably damaging	Het
Ighv13-1	T	C	12: 114,267,632		probably benign	Het
Igkv4-50	T	C	6: 69,701,000	K40R	probably benign	Het
Igkv8-18	T	A	6: 70,356,296	I74N	probably damaging	Het
Kbtbd7	T	C	14: 79,428,800	*691Q	probably null	Het
Khnyn	T	A	14: 55,886,489		probably null	Het
Kif26a	G	A	12: 112,175,573	A754T	probably benign	Het
Llgl1	T	A	11: 60,706,225	L194*	probably null	Het
Map3k12	G	T	15: 102,501,282	T686N	probably benign	Het
Myo18a	C	A	11: 77,829,759	P741Q	probably benign	Het
Ncaph2	G	A	15: 89,355,827		probably benign	Het
Nfkb2	A	G	19: 46,308,964	Q406R	possibly damaging	Het
Olfr1378	G	A	11: 50,969,266	V83M	possibly damaging	Het
Olfr138	T	A	17: 38,275,547	Y259N	probably damaging	Het
Olfr744	T	A	14: 50,618,569	C116S	probably benign	Het
Olfr874	A	T	9: 37,746,535	T134S	probably benign	Het
Olfr94	T	C	17: 37,197,024	T315A	probably damaging	Het
Olfr980	A	T	9: 40,006,268	I227N	probably damaging	Het
Ostm1	C	T	10: 42,678,979		probably benign	Het
Pabpc1	A	T	15: 36,599,284	V389E	probably benign	Het
Pank4	A	T	4: 154,971,390	M291L	probably benign	Het
Pex6	A	G	17: 46,722,288	D579G	probably benign	Het
Pex6	A	G	17: 46,724,707		probably null	Het
Phc2	C	T	4: 128,707,971	T73M	probably damaging	Het
Pkp4	G	A	2: 59,334,932		probably null	Het
Plekhg1	T	A	10: 3,957,506	S808T	probably benign	Het
Plk5	A	T	10: 80,358,797	H118L	probably damaging	Het
Pnlip	T	C	19: 58,676,487	I249T	probably benign	Het
Ptov1	T	C	7: 44,867,109	D134G	probably benign	Het
Ptprb	T	C	10: 116,319,333	V664A	probably benign	Het
Ptprz1	T	A	6: 23,002,610	S1566R	probably benign	Het
Pum1	T	C	4: 130,718,193	S158P	probably benign	Het
Rae1	G	T	2: 173,015,392		probably benign	Het
Ros1	A	C	10: 52,142,229	W778G	probably damaging	Het
Sacm1l	G	A	9: 123,590,830	V553I	probably benign	Het
Samd4b	G	A	7: 28,406,663	R377W	probably benign	Het
Selenoo	A	G	15: 89,099,328	Q524R	probably benign	Het
Slc30a3	T	C	5: 31,093,294	S22G	probably benign	Het
Slc35g2	A	C	9: 100,552,502	V372G	probably benign	Het
Slc5a8	T	C	10: 88,925,787		probably null	Het
Slc7a7	T	C	14: 54,408,733	Y91C	probably damaging	Het
Slc7a9	T	A	7: 35,453,563	Y135*	probably null	Het
Slfn1	A	T	11: 83,121,835	E259V	probably damaging	Het
Slmap	T	C	14: 26,468,535	N156S	probably damaging	Het
Sorbs1	T	A	19: 40,314,689	R485S	probably benign	Het
Sptbn2	T	A	19: 4,742,480	F1388I	probably damaging	Het
Stac2	C	T	11: 98,039,695	G349E	probably damaging	Het
Tigd2	T	A	6: 59,211,415	H422Q	probably benign	Het
Tle1	T	C	4: 72,125,019	N538D	possibly damaging	Het
Tmtc1	A	C	6: 148,284,980		probably null	Het
Tns3	C	T	11: 8,450,986	R1104H	probably benign	Het
Tom1l2	C	G	11: 60,270,433	R84P	probably damaging	Het
Trank1	T	C	9: 111,390,410	F2072L	probably damaging	Het
Trim6	T	C	7: 104,232,648	Y369H	probably damaging	Het
Trpc7	A	G	13: 56,804,553	S541P	probably damaging	Het
Trpv4	T	C	5: 114,622,753	D732G	possibly damaging	Het
Tsc2	C	A	17: 24,603,275	V1141F	possibly damaging	Het
Tspoap1	T	A	11: 87,765,647	V257E	probably benign	Het
Ttn	A	T	2: 76,943,011	M2395K	unknown	Het
Ubd	A	C	17: 37,195,702	T160P	probably benign	Het
Ubr7	A	G	12: 102,769,226	T315A	probably benign	Het
Ugt2b36	G	T	5: 87,081,538	Y156*	probably null	Het
Ulk4	G	A	9: 121,263,638	R178*	probably null	Het
Urod	G	A	4: 116,991,673	A92V	possibly damaging	Het
Utp20	T	C	10: 88,754,520	D2364G	possibly damaging	Het
Vmn1r87	A	T	7: 13,132,327	M11K	possibly damaging	Het
Vstm4	A	G	14: 32,917,902	K96E	possibly damaging	Het
Wwp1	T	C	4: 19,661,990	D172G	probably benign	Het
Zfhx3	A	G	8: 108,956,084	Q3385R	unknown	Het
Zfp229	C	T	17: 21,745,286	H166Y	possibly damaging	Het
Zfp738	A	T	13: 67,669,914	C653S	probably damaging	Het
Zp2	C	A	7: 120,138,120	V282L	probably damaging	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11834092	splice site	probably benign
IGL00757:Ryr2	APN	13	11618604	splice site	probably null
IGL00838:Ryr2	APN	13	11568503	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11585478	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11735502	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11703544	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11638485	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11587239	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11556685	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11591352	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11742036	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11799837	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11851204	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11721790	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11721761	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11601758	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11591316	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11594968	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11692677	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11585480	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11601842	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11595425	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11554550	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11790363	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11597112	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11747564	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11572257	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11792762	nonsense	probably null
IGL02086:Ryr2	APN	13	11735556	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11759759	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11737873	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11741869	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11730388	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11747658	splice site	probably benign
IGL02369:Ryr2	APN	13	11619496	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11722721	splice site	probably benign
IGL02400:Ryr2	APN	13	11605244	splice site	probably benign
IGL02423:Ryr2	APN	13	11745198	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11745674	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11705699	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11554511	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11605189	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11738320	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11655677	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11595190	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11707793	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11918319	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11591269	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11759835	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11684479	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11643902	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11635582	splice site	probably benign
IGL03152:Ryr2	APN	13	11853150	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11742023	nonsense	probably null
IGL03180:Ryr2	APN	13	11568563	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11724387	splice site	probably benign
IGL03390:Ryr2	APN	13	11772416	missense	probably benign
IGL03410:Ryr2	APN	13	11588147	missense	probably damaging	0.99
Arruda	UTSW	13	11643895	missense	probably damaging	1.00
Arruda2	UTSW	13	11879496	missense	probably damaging	1.00
Arruda3	UTSW	13	11555448	missense	possibly damaging	0.91
barricuda	UTSW	13	11595014	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB006:Ryr2	UTSW	13	11690295	nonsense	probably null
BB016:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11690295	nonsense	probably null
H8562:Ryr2	UTSW	13	11717141	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11665962	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11761306	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11707796	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11594755	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11555448	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11824379	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11665919	missense	probably benign
R0018:Ryr2	UTSW	13	11595223	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11595784	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11669038	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11869116	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11568475	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11709921	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11714548	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11676251	splice site	probably benign
R0226:Ryr2	UTSW	13	11772556	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11716977	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11668839	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11705684	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11834095	splice site	probably benign
R0558:Ryr2	UTSW	13	11638443	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11799861	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11731669	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11635559	missense	probably null
R0601:Ryr2	UTSW	13	11705633	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11622952	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11724333	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11566885	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11738126	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11554529	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11669969	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11945981	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11660113	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11883043	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11687879	splice site	probably benign
R1400:Ryr2	UTSW	13	11595076	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11714503	splice site	probably benign
R1443:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11738149	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11727022	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11601841	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11554592	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11554549	nonsense	probably null
R1551:Ryr2	UTSW	13	11785143	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11759677	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11794563	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11718482	nonsense	probably null
R1686:Ryr2	UTSW	13	11603779	splice site	probably benign
R1696:Ryr2	UTSW	13	11731657	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11587442	splice site	probably null
R1728:Ryr2	UTSW	13	11587422	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11790267	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11745176	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11700371	nonsense	probably null
R1801:Ryr2	UTSW	13	11595281	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11560586	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11587316	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11769878	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11731700	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11662075	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11738356	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11658958	nonsense	probably null
R1897:Ryr2	UTSW	13	11750932	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11591336	missense	probably benign
R1909:Ryr2	UTSW	13	11700349	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11556698	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11731723	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11681080	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11585402	splice site	probably null
R2018:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11851188	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11595736	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11665878	splice site	probably null
R2088:Ryr2	UTSW	13	11662229	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11945977	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11712195	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11560607	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11577873	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11705793	nonsense	probably null
R2207:Ryr2	UTSW	13	11810937	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11662260	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11738216	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11738242	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11591237	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11801848	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11759703	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11593093	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11761349	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11772580	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11588159	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11738209	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11772427	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11918414	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11692682	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11779267	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11587437	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11737873	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11750725	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11649812	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11605233	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11717066	nonsense	probably null
R4430:Ryr2	UTSW	13	11735527	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12106415	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11749509	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11750685	splice site	probably null
R4668:Ryr2	UTSW	13	11593117	missense	probably benign
R4677:Ryr2	UTSW	13	11706667	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11824369	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11595233	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11692646	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11716998	missense	probably damaging	1.00
R4732:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11577909	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11737753	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11657047	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11708227	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11687932	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11717097	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11655698	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11668820	missense	probably damaging	0.99
R4850:Ryr2	UTSW	13	11745752	missense	probably damaging	1.00
R4880:Ryr2	UTSW	13	11752218	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11594986	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11709963	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11945945	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11742011	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11785080	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4964:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4966:Ryr2	UTSW	13	11714611	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11833992	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11595306	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11643895	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11587254	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11635536	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11700354	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11712243	nonsense	probably null
R5135:Ryr2	UTSW	13	11662130	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11660289	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11752321	missense	probably benign
R5187:Ryr2	UTSW	13	11772452	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11638430	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11772437	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11690363	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11556658	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11705656	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11705701	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11745601	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11687909	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11555448	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11595014	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11708202	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11601805	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11595582	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11759836	missense	probably damaging	1.00
R5775:Ryr2	UTSW	13	11769962	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11603732	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11560574	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11584154	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11790332	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11687902	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11660122	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11726953	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11662238	nonsense	probably null
R5974:Ryr2	UTSW	13	11714511	splice site	probably null
R6104:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11792689	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11669017	missense	probably benign
R6208:Ryr2	UTSW	13	11895220	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11834078	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11660107	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11879496	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11761396	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11662383	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11834007	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11668821	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11710065	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11595643	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11594723	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11738462	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11686966	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11726930	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11829654	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11827559	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11745601	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11566948	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11801243	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11654380	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11712166	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11794605	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11824400	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11649776	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11669987	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11655713	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11640327	missense	possibly damaging	0.63
R7131:Ryr2	UTSW	13	11668811	critical splice donor site	probably null
R7159:Ryr2	UTSW	13	11810908	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11801177	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11686978	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11759757	missense	probably benign
R7189:Ryr2	UTSW	13	11883123	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11665913	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11597146	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11738194	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11745631	missense	probably benign
R7365:Ryr2	UTSW	13	11640275	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11680999	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11785111	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11735620	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11556748	splice site	probably null
R7425:Ryr2	UTSW	13	11705644	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11555463	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11752282	missense	probably benign
R7460:Ryr2	UTSW	13	11705710	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11594876	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11638431	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11737985	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11799825	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11560653	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11761327	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11761315	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11690333	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11730343	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11751011	missense	probably benign
R7797:Ryr2	UTSW	13	11801180	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11827607	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11706623	nonsense	probably null
R7872:Ryr2	UTSW	13	11595724	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11792748	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11594794	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11690295	nonsense	probably null
R7952:Ryr2	UTSW	13	11646427	splice site	probably null
R8008:Ryr2	UTSW	13	11657094	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11588140	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11945995	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11603698	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11827553	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11595506	nonsense	probably null
R8351:Ryr2	UTSW	13	11799832	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11668935	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11684478	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11659008	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11577778	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11560593	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11687989	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11686947	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11668969	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11735623	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11558048	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11779266	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11785104	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11799882	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11595038	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11603732	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11594786	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11738103	nonsense	probably null
R9056:Ryr2	UTSW	13	11595931	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11601838	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11603855	intron	probably benign
R9116:Ryr2	UTSW	13	11572299	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11654406	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11885538	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11829674	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11595886	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11750968	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11883090	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11706692	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11883116	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11681087	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11794573	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11772577	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11737794	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11556604	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11587215	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11745218	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11668962	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11722760	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11687049	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11594899	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11692713	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11869156	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11703501	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11598611	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11643803	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11794549	nonsense	probably null
Z1177:Ryr2	UTSW	13	11750873	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAAATGCGTCCCTTGTCCCC -3'
(R):5'- ATCACAGCAGTCTTTCCTGTGC -3'

Sequencing Primer
(F):5'- CATCCCATGTAAGGCAGAAGTGTC -3'
(R):5'- GCCTCCCTTACTAAGAGGGGTATC -3'

Posted On

2015-11-11