Incidental Mutation 'R4731:Adcy8'
ID 358887
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Name adenylate cyclase 8
Synonyms AC8
MMRRC Submission 042021-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4731 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 64570884-64794145 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64626711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 709 (V709A)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
AlphaFold P97490
Predicted Effect possibly damaging
Transcript: ENSMUST00000023007
AA Change: V709A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: V709A

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228014
AA Change: V709A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actmap T A 7: 26,900,468 (GRCm39) M149K probably damaging Het
Adamts12 A T 15: 11,270,748 (GRCm39) S668C probably damaging Het
Aim2 T A 1: 173,291,442 (GRCm39) D282E possibly damaging Het
Akap9 T A 5: 4,012,266 (GRCm39) S990T possibly damaging Het
Aloxe3 A T 11: 69,019,480 (GRCm39) D131V probably null Het
Ankrd28 A C 14: 31,477,698 (GRCm39) C115G probably benign Het
Anxa2 A T 9: 69,393,812 (GRCm39) M217L probably benign Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Btaf1 A G 19: 36,958,478 (GRCm39) D665G probably benign Het
Cdc42bpg T A 19: 6,361,221 (GRCm39) V282E probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cdipt T A 7: 126,577,530 (GRCm39) L92H probably damaging Het
Cep104 T A 4: 154,072,883 (GRCm39) D380E probably damaging Het
Cfap74 T A 4: 155,548,059 (GRCm39) probably benign Het
Chd1 A T 17: 17,598,079 (GRCm39) E55D probably benign Het
Cldnd2 T A 7: 43,091,613 (GRCm39) C65S possibly damaging Het
Clec9a G T 6: 129,393,299 (GRCm39) A108S probably benign Het
Cog7 T C 7: 121,563,467 (GRCm39) D215G probably benign Het
Col9a3 G A 2: 180,252,474 (GRCm39) E373K probably damaging Het
Deptor C A 15: 55,044,406 (GRCm39) H191N probably benign Het
Dgkz A T 2: 91,768,684 (GRCm39) I699N probably damaging Het
Dnah7c T A 1: 46,809,333 (GRCm39) N3550K probably damaging Het
Dnah8 A G 17: 30,994,035 (GRCm39) K3384R probably null Het
Dnajc13 CT C 9: 104,064,004 (GRCm39) probably benign Het
Dnhd1 C A 7: 105,323,056 (GRCm39) N521K probably benign Het
Efhb G A 17: 53,733,272 (GRCm39) T533I probably damaging Het
Ercc4 A T 16: 12,965,471 (GRCm39) H701L probably damaging Het
Ern1 A T 11: 106,325,676 (GRCm39) probably benign Het
Etfb T C 7: 43,093,624 (GRCm39) V17A probably damaging Het
Evc T A 5: 37,481,141 (GRCm39) M235L probably benign Het
Fbxw22 T C 9: 109,207,937 (GRCm39) I445V probably benign Het
Fmnl2 A G 2: 53,007,081 (GRCm39) T764A possibly damaging Het
Fto T A 8: 92,136,342 (GRCm39) D205E probably damaging Het
Galntl6 G A 8: 58,880,847 (GRCm39) P147L probably damaging Het
Gm6871 T C 7: 41,196,173 (GRCm39) I39V probably benign Het
Gpr83 A G 9: 14,777,470 (GRCm39) probably benign Het
Gucy1a2 A T 9: 3,759,424 (GRCm39) H410L probably benign Het
Helb T C 10: 119,930,193 (GRCm39) probably null Het
Ifi214 T C 1: 173,354,157 (GRCm39) Q171R probably benign Het
Ifit1bl1 T C 19: 34,571,721 (GRCm39) I245M probably benign Het
Igdcc3 A G 9: 65,089,279 (GRCm39) T492A probably damaging Het
Ighv13-1 T C 12: 114,231,252 (GRCm39) probably benign Het
Igkv4-50 T C 6: 69,677,984 (GRCm39) K40R probably benign Het
Igkv8-18 T A 6: 70,333,280 (GRCm39) I74N probably damaging Het
Iho1 A G 9: 108,282,584 (GRCm39) V368A probably benign Het
Kbtbd7 T C 14: 79,666,240 (GRCm39) *691Q probably null Het
Khnyn T A 14: 56,123,946 (GRCm39) probably null Het
Kif26a G A 12: 112,142,007 (GRCm39) A754T probably benign Het
Llgl1 T A 11: 60,597,051 (GRCm39) L194* probably null Het
Map3k12 G T 15: 102,409,717 (GRCm39) T686N probably benign Het
Myo18a C A 11: 77,720,585 (GRCm39) P741Q probably benign Het
Ncaph2 G A 15: 89,240,030 (GRCm39) probably benign Het
Nfkb2 A G 19: 46,297,403 (GRCm39) Q406R possibly damaging Het
Or10g9b A T 9: 39,917,564 (GRCm39) I227N probably damaging Het
Or11g2 T A 14: 50,856,026 (GRCm39) C116S probably benign Het
Or1ad6 G A 11: 50,860,093 (GRCm39) V83M possibly damaging Het
Or2i1 T C 17: 37,507,915 (GRCm39) T315A probably damaging Het
Or2n1e T A 17: 38,586,438 (GRCm39) Y259N probably damaging Het
Or8b12 A T 9: 37,657,831 (GRCm39) T134S probably benign Het
Ostm1 C T 10: 42,554,975 (GRCm39) probably benign Het
Pabpc1 A T 15: 36,599,528 (GRCm39) V389E probably benign Het
Pank4 A T 4: 155,055,847 (GRCm39) M291L probably benign Het
Pex6 A G 17: 47,033,214 (GRCm39) D579G probably benign Het
Pex6 A G 17: 47,035,633 (GRCm39) probably null Het
Phc2 C T 4: 128,601,764 (GRCm39) T73M probably damaging Het
Pkp4 G A 2: 59,165,276 (GRCm39) probably null Het
Plekhg1 T A 10: 3,907,506 (GRCm39) S808T probably benign Het
Plk5 A T 10: 80,194,631 (GRCm39) H118L probably damaging Het
Pnlip T C 19: 58,664,919 (GRCm39) I249T probably benign Het
Ptov1 T C 7: 44,516,533 (GRCm39) D134G probably benign Het
Ptprb T C 10: 116,155,238 (GRCm39) V664A probably benign Het
Ptprz1 T A 6: 23,002,609 (GRCm39) S1566R probably benign Het
Pum1 T C 4: 130,445,504 (GRCm39) S158P probably benign Het
Rae1 G T 2: 172,857,185 (GRCm39) probably benign Het
Ros1 A C 10: 52,018,325 (GRCm39) W778G probably damaging Het
Ryr2 A T 13: 11,592,795 (GRCm39) M4653K possibly damaging Het
Sacm1l G A 9: 123,419,895 (GRCm39) V553I probably benign Het
Samd4b G A 7: 28,106,088 (GRCm39) R377W probably benign Het
Selenoo A G 15: 88,983,531 (GRCm39) Q524R probably benign Het
Slc30a3 T C 5: 31,250,638 (GRCm39) S22G probably benign Het
Slc35g2 A C 9: 100,434,555 (GRCm39) V372G probably benign Het
Slc5a8 T C 10: 88,761,649 (GRCm39) probably null Het
Slc7a7 T C 14: 54,646,190 (GRCm39) Y91C probably damaging Het
Slc7a9 T A 7: 35,152,988 (GRCm39) Y135* probably null Het
Slfn1 A T 11: 83,012,661 (GRCm39) E259V probably damaging Het
Slmap T C 14: 26,189,690 (GRCm39) N156S probably damaging Het
Smim29 A G 17: 27,784,244 (GRCm39) probably benign Het
Sorbs1 T A 19: 40,303,133 (GRCm39) R485S probably benign Het
Sptbn2 T A 19: 4,792,508 (GRCm39) F1388I probably damaging Het
Stac2 C T 11: 97,930,521 (GRCm39) G349E probably damaging Het
Tigd2 T A 6: 59,188,400 (GRCm39) H422Q probably benign Het
Tle1 T C 4: 72,043,256 (GRCm39) N538D possibly damaging Het
Tmtc1 A C 6: 148,186,478 (GRCm39) probably null Het
Tns3 C T 11: 8,400,986 (GRCm39) R1104H probably benign Het
Tom1l2 C G 11: 60,161,259 (GRCm39) R84P probably damaging Het
Trank1 T C 9: 111,219,478 (GRCm39) F2072L probably damaging Het
Trim6 T C 7: 103,881,855 (GRCm39) Y369H probably damaging Het
Trpc7 A G 13: 56,952,366 (GRCm39) S541P probably damaging Het
Trpv4 T C 5: 114,760,814 (GRCm39) D732G possibly damaging Het
Tsc2 C A 17: 24,822,249 (GRCm39) V1141F possibly damaging Het
Tspoap1 T A 11: 87,656,473 (GRCm39) V257E probably benign Het
Ttn A T 2: 76,773,355 (GRCm39) M2395K unknown Het
Ubd A C 17: 37,506,593 (GRCm39) T160P probably benign Het
Ubr7 A G 12: 102,735,485 (GRCm39) T315A probably benign Het
Ugt2b36 G T 5: 87,229,397 (GRCm39) Y156* probably null Het
Ulk4 G A 9: 121,092,704 (GRCm39) R178* probably null Het
Urod G A 4: 116,848,870 (GRCm39) A92V possibly damaging Het
Utp20 T C 10: 88,590,382 (GRCm39) D2364G possibly damaging Het
Vmn1r87 A T 7: 12,866,254 (GRCm39) M11K possibly damaging Het
Vstm4 A G 14: 32,639,859 (GRCm39) K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 (GRCm39) D172G probably benign Het
Zfhx3 A G 8: 109,682,716 (GRCm39) Q3385R unknown Het
Zfp229 C T 17: 21,964,267 (GRCm39) H166Y possibly damaging Het
Zfp738 A T 13: 67,818,033 (GRCm39) C653S probably damaging Het
Zp2 C A 7: 119,737,343 (GRCm39) V282L probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64,659,216 (GRCm39) missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64,571,151 (GRCm39) missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64,694,162 (GRCm39) missense probably benign 0.07
IGL01083:Adcy8 APN 15 64,659,191 (GRCm39) missense probably benign 0.21
IGL01296:Adcy8 APN 15 64,655,628 (GRCm39) missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64,609,263 (GRCm39) missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64,687,170 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64,678,511 (GRCm39) missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64,694,069 (GRCm39) missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64,659,303 (GRCm39) missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64,655,833 (GRCm39) missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64,618,744 (GRCm39) critical splice donor site probably null
IGL03180:Adcy8 APN 15 64,655,799 (GRCm39) missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64,792,116 (GRCm39) missense probably damaging 1.00
revolutionary UTSW 15 64,571,236 (GRCm39) missense probably damaging 1.00
whirligig UTSW 15 64,571,134 (GRCm39) missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64,694,083 (GRCm39) missense probably benign 0.38
K7894:Adcy8 UTSW 15 64,694,083 (GRCm39) missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64,626,666 (GRCm39) missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64,571,217 (GRCm39) missense probably benign 0.29
R0119:Adcy8 UTSW 15 64,588,015 (GRCm39) missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64,618,862 (GRCm39) missense probably benign 0.18
R0299:Adcy8 UTSW 15 64,588,015 (GRCm39) missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64,694,044 (GRCm39) missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64,618,780 (GRCm39) missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64,587,911 (GRCm39) missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64,743,625 (GRCm39) missense probably benign 0.25
R1881:Adcy8 UTSW 15 64,678,503 (GRCm39) missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2014:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2015:Adcy8 UTSW 15 64,639,727 (GRCm39) missense probably benign 0.00
R2164:Adcy8 UTSW 15 64,792,783 (GRCm39) missense probably benign
R2228:Adcy8 UTSW 15 64,694,056 (GRCm39) missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64,694,056 (GRCm39) missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64,571,230 (GRCm39) missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64,571,008 (GRCm39) missense probably benign 0.10
R3277:Adcy8 UTSW 15 64,571,008 (GRCm39) missense probably benign 0.10
R3404:Adcy8 UTSW 15 64,571,449 (GRCm39) missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64,743,556 (GRCm39) missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64,597,384 (GRCm39) splice site probably benign
R3710:Adcy8 UTSW 15 64,597,384 (GRCm39) splice site probably benign
R3778:Adcy8 UTSW 15 64,618,846 (GRCm39) missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64,597,319 (GRCm39) missense probably benign 0.06
R4685:Adcy8 UTSW 15 64,609,287 (GRCm39) missense probably benign 0.09
R4732:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64,626,711 (GRCm39) missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64,659,207 (GRCm39) missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64,678,553 (GRCm39) missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64,639,706 (GRCm39) missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64,588,001 (GRCm39) missense probably benign 0.04
R5403:Adcy8 UTSW 15 64,588,001 (GRCm39) missense probably benign 0.04
R5521:Adcy8 UTSW 15 64,687,199 (GRCm39) missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64,571,134 (GRCm39) missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64,626,715 (GRCm39) missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64,792,320 (GRCm39) missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64,576,067 (GRCm39) missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64,588,031 (GRCm39) missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64,687,266 (GRCm39) missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64,689,488 (GRCm39) splice site probably null
R6338:Adcy8 UTSW 15 64,792,466 (GRCm39) missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64,571,236 (GRCm39) missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64,609,243 (GRCm39) nonsense probably null
R6636:Adcy8 UTSW 15 64,659,251 (GRCm39) missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64,626,735 (GRCm39) critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64,576,565 (GRCm39) missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64,792,404 (GRCm39) missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64,743,619 (GRCm39) missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64,571,067 (GRCm39) missense probably benign 0.19
R7457:Adcy8 UTSW 15 64,792,529 (GRCm39) missense possibly damaging 0.79
R7611:Adcy8 UTSW 15 64,792,882 (GRCm39) missense probably benign
R7644:Adcy8 UTSW 15 64,571,218 (GRCm39) missense possibly damaging 0.77
R7697:Adcy8 UTSW 15 64,618,850 (GRCm39) missense probably benign
R7735:Adcy8 UTSW 15 64,655,629 (GRCm39) missense probably benign 0.10
R7789:Adcy8 UTSW 15 64,743,623 (GRCm39) nonsense probably null
R7860:Adcy8 UTSW 15 64,571,322 (GRCm39) missense probably damaging 0.97
R7894:Adcy8 UTSW 15 64,792,054 (GRCm39) missense possibly damaging 0.60
R7948:Adcy8 UTSW 15 64,687,199 (GRCm39) missense possibly damaging 0.80
R7966:Adcy8 UTSW 15 64,573,939 (GRCm39) missense probably damaging 1.00
R8024:Adcy8 UTSW 15 64,792,095 (GRCm39) missense probably damaging 1.00
R8097:Adcy8 UTSW 15 64,743,711 (GRCm39) splice site probably null
R8158:Adcy8 UTSW 15 64,655,655 (GRCm39) missense probably benign 0.32
R8463:Adcy8 UTSW 15 64,792,874 (GRCm39) missense probably benign
R8474:Adcy8 UTSW 15 64,576,638 (GRCm39) missense probably damaging 0.98
R8696:Adcy8 UTSW 15 64,687,235 (GRCm39) missense probably benign 0.30
R8955:Adcy8 UTSW 15 64,576,554 (GRCm39) missense possibly damaging 0.92
R8973:Adcy8 UTSW 15 64,570,984 (GRCm39) makesense probably null
R9015:Adcy8 UTSW 15 64,597,206 (GRCm39) intron probably benign
R9041:Adcy8 UTSW 15 64,609,287 (GRCm39) missense probably benign 0.31
R9052:Adcy8 UTSW 15 64,792,764 (GRCm39) missense probably benign 0.00
R9074:Adcy8 UTSW 15 64,573,940 (GRCm39) missense probably damaging 0.96
R9183:Adcy8 UTSW 15 64,694,116 (GRCm39) missense probably damaging 0.98
R9259:Adcy8 UTSW 15 64,576,604 (GRCm39) missense probably damaging 1.00
R9498:Adcy8 UTSW 15 64,792,045 (GRCm39) missense possibly damaging 0.88
R9522:Adcy8 UTSW 15 64,792,560 (GRCm39) missense probably damaging 0.99
R9800:Adcy8 UTSW 15 64,571,095 (GRCm39) missense probably benign 0.19
Z1176:Adcy8 UTSW 15 64,597,367 (GRCm39) missense probably benign 0.16
Z1177:Adcy8 UTSW 15 64,571,026 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTGACAGGTCAGATGGATG -3'
(R):5'- ATGAATAGCCTGCCCTGTGTG -3'

Sequencing Primer
(F):5'- ACAGGTCAGATGGATGGCTCC -3'
(R):5'- ATTTTGGGTGAAACAGCTTCC -3'
Posted On 2015-11-11