Incidental Mutation 'R4731:Chd1'
ID358892
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 042021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4731 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17377817 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 55 (E55D)
Ref Sequence ENSEMBL: ENSMUSP00000024620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024620] [ENSMUST00000232199] [ENSMUST00000232396]
Predicted Effect probably benign
Transcript: ENSMUST00000024620
AA Change: E55D

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024620
Gene: ENSMUSG00000116564
AA Change: E55D

DomainStartEndE-ValueType
Pfam:Rio2_N 9 91 9.5e-36 PFAM
Pfam:Kdo 105 193 6.3e-8 PFAM
Pfam:RIO1 108 284 1.7e-57 PFAM
Pfam:APH 194 278 3.2e-8 PFAM
low complexity region 326 340 N/A INTRINSIC
low complexity region 501 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232288
Predicted Effect probably benign
Transcript: ENSMUST00000232396
AA Change: E55D

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (117/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
AI413582 A G 17: 27,565,270 probably benign Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Akap9 T A 5: 3,962,266 S990T possibly damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Anxa2 A T 9: 69,486,530 M217L probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
Btaf1 A G 19: 36,981,078 D665G probably benign Het
Ccdc36 A G 9: 108,405,385 V368A probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cfap74 T A 4: 155,463,602 probably benign Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec9a G T 6: 129,416,336 A108S probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col9a3 G A 2: 180,610,681 E373K probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnajc13 CT C 9: 104,186,805 probably benign Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Ercc4 A T 16: 13,147,607 H701L probably damaging Het
Ern1 A T 11: 106,434,850 probably benign Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
Evc T A 5: 37,323,797 M235L probably benign Het
Fbxw22 T C 9: 109,378,869 I445V probably benign Het
Fmnl2 A G 2: 53,117,069 T764A possibly damaging Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr83 A G 9: 14,866,174 probably benign Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Helb T C 10: 120,094,288 probably null Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Ifit1bl1 T C 19: 34,594,321 I245M probably benign Het
Igdcc3 A G 9: 65,181,997 T492A probably damaging Het
Ighv13-1 T C 12: 114,267,632 probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Llgl1 T A 11: 60,706,225 L194* probably null Het
Map3k12 G T 15: 102,501,282 T686N probably benign Het
Myo18a C A 11: 77,829,759 P741Q probably benign Het
Ncaph2 G A 15: 89,355,827 probably benign Het
Nfkb2 A G 19: 46,308,964 Q406R possibly damaging Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr874 A T 9: 37,746,535 T134S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Ostm1 C T 10: 42,678,979 probably benign Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Phc2 C T 4: 128,707,971 T73M probably damaging Het
Pkp4 G A 2: 59,334,932 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Plk5 A T 10: 80,358,797 H118L probably damaging Het
Pnlip T C 19: 58,676,487 I249T probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprb T C 10: 116,319,333 V664A probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Rae1 G T 2: 173,015,392 probably benign Het
Ros1 A C 10: 52,142,229 W778G probably damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Samd4b G A 7: 28,406,663 R377W probably benign Het
Selenoo A G 15: 89,099,328 Q524R probably benign Het
Slc30a3 T C 5: 31,093,294 S22G probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc5a8 T C 10: 88,925,787 probably null Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slfn1 A T 11: 83,121,835 E259V probably damaging Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Sptbn2 T A 19: 4,742,480 F1388I probably damaging Het
Stac2 C T 11: 98,039,695 G349E probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trank1 T C 9: 111,390,410 F2072L probably damaging Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Trpc7 A G 13: 56,804,553 S541P probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Tspoap1 T A 11: 87,765,647 V257E probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ubr7 A G 12: 102,769,226 T315A probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Utp20 T C 10: 88,754,520 D2364G possibly damaging Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zfhx3 A G 8: 108,956,084 Q3385R unknown Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp738 A T 13: 67,669,914 C653S probably damaging Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCTATACCTGTTAGGCTACACAG -3'
(R):5'- TTGAATGGCAGAAGAACGTGTC -3'

Sequencing Primer
(F):5'- AGAGAGTTTCGAGAGGCTAATTTC -3'
(R):5'- GAACGTGTCAGTTCTTGCCCTG -3'
Posted On2015-11-11