Incidental Mutation 'R0321:Pkdcc'
ID 35894
Institutional Source Beutler Lab
Gene Symbol Pkdcc
Ensembl Gene ENSMUSG00000024247
Gene Name protein kinase domain containing, cytoplasmic
Synonyms MAd1, Vlk, Adtk1, ESTM17
MMRRC Submission 038531-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0321 (G1)
Quality Score 213
Status Validated
Chromosome 17
Chromosomal Location 83215292-83225070 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 83222112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170794]
AlphaFold Q5RJI4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168118
Predicted Effect probably benign
Transcript: ENSMUST00000170758
Predicted Effect probably benign
Transcript: ENSMUST00000170794
SMART Domains Protein: ENSMUSP00000129238
Gene: ENSMUSG00000024247

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 92 128 N/A INTRINSIC
Pfam:Pkinase 139 321 1.3e-5 PFAM
Pfam:PIP49_C 196 373 3.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Homozygous null mutants die on postnatal day P0, apparently due to ineffective respiration. They exhibit shortening of all the long bones of the fore- and hindlimbs, cleft palate, sternal dysraphia and deficient mineralization or other anomalies of multiple bones throughout the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,700 T353A probably benign Het
4932438A13Rik T C 3: 36,906,788 probably null Het
4933402N03Rik T A 7: 131,146,227 Y12F probably benign Het
Acbd3 T G 1: 180,752,305 F505V probably damaging Het
Acod1 T C 14: 103,055,129 V363A probably benign Het
Adam28 T C 14: 68,617,751 Q647R probably damaging Het
Akr1c18 T A 13: 4,135,244 L296F probably damaging Het
Ap1b1 G A 11: 5,032,464 A588T probably benign Het
Armc8 A T 9: 99,533,177 I150K probably damaging Het
Bahcc1 T C 11: 120,273,425 probably null Het
Carmil3 C A 14: 55,502,241 D928E possibly damaging Het
Ccrl2 T C 9: 111,056,211 N73S probably damaging Het
Cdk9 C A 2: 32,712,686 probably benign Het
Cel G T 2: 28,561,148 Q66K probably benign Het
D930028M14Rik T A 7: 25,155,566 noncoding transcript Het
Dgka G C 10: 128,721,083 probably benign Het
Dlg1 T C 16: 31,858,036 V801A probably damaging Het
Dnah10 A G 5: 124,823,352 D3834G probably benign Het
Dnajc15 C T 14: 77,874,833 A23T possibly damaging Het
Ell2 T A 13: 75,761,888 L119Q probably damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
F10 T C 8: 13,053,413 F266L possibly damaging Het
Fam110a T C 2: 151,970,667 N61S probably benign Het
Fam83c C T 2: 155,829,700 S605N probably benign Het
Fbxw15 C T 9: 109,565,385 V121I probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gfi1b A G 2: 28,613,885 F101S probably damaging Het
Gimap5 C G 6: 48,750,515 probably benign Het
Gpr180 T C 14: 118,148,287 probably null Het
Gsn T C 2: 35,290,396 F188L probably benign Het
Hivep3 T A 4: 120,095,591 I368N possibly damaging Het
Itih3 T A 14: 30,912,106 I153F probably damaging Het
Kdm8 A T 7: 125,461,006 Q360L probably damaging Het
Lars T C 18: 42,202,632 K1140E probably damaging Het
Mocs1 A G 17: 49,433,258 Y71C probably damaging Het
Mroh5 C T 15: 73,790,043 G433E probably damaging Het
Mrpl45 T A 11: 97,326,938 probably benign Het
Mtcl1 T A 17: 66,379,431 T827S probably damaging Het
Muc5b T C 7: 141,862,235 S2973P probably benign Het
Mynn T C 3: 30,607,557 S263P probably benign Het
Myo1f A C 17: 33,593,012 D595A probably benign Het
Necab1 A T 4: 14,960,083 I288N probably damaging Het
Nutm2 T G 13: 50,472,955 M382R probably damaging Het
Oprm1 T C 10: 6,829,183 S131P probably damaging Het
Pcsk9 A G 4: 106,444,694 S619P probably benign Het
Phkg1 A T 5: 129,869,524 M1K probably null Het
Pigc C T 1: 161,971,099 Q217* probably null Het
Pik3r4 T A 9: 105,648,707 F259I probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prtg A T 9: 72,848,025 I259F possibly damaging Het
Prune2 T G 19: 17,120,927 L1265R possibly damaging Het
Prune2 C T 19: 17,122,454 A1774V probably benign Het
Rcn3 A G 7: 45,088,715 probably benign Het
Rnf213 C T 11: 119,438,105 Q2067* probably null Het
Sec14l1 T A 11: 117,150,742 probably benign Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Smpdl3b A T 4: 132,741,444 V154E probably damaging Het
Spag17 T C 3: 100,101,403 S1950P probably damaging Het
Sprr1a T C 3: 92,484,302 T131A probably benign Het
Tatdn2 T G 6: 113,709,501 L690W probably damaging Het
Tbc1d1 T C 5: 64,339,594 F864L probably damaging Het
Tmem8b C A 4: 43,674,444 R243S probably damaging Het
Tnfrsf11a T A 1: 105,844,857 C623* probably null Het
Tprgl T C 4: 154,159,355 N115D probably damaging Het
Ube2t C T 1: 134,967,800 A4V possibly damaging Het
Vps41 G A 13: 18,842,295 probably benign Het
Wdr17 C T 8: 54,696,268 probably null Het
Wwc1 G A 11: 35,841,810 Q1024* probably null Het
Zfand5 T A 19: 21,276,515 N27K probably damaging Het
Zfp142 A T 1: 74,569,714 C1641S probably damaging Het
Zfyve16 A G 13: 92,492,534 I1465T probably damaging Het
Zswim1 G A 2: 164,826,027 G400S probably benign Het
Zswim3 C T 2: 164,820,359 A253V possibly damaging Het
Other mutations in Pkdcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Pkdcc APN 17 83220119 missense probably damaging 1.00
IGL02517:Pkdcc APN 17 83223866 missense probably damaging 1.00
PIT4791001:Pkdcc UTSW 17 83220148 nonsense probably null
R0180:Pkdcc UTSW 17 83221870 critical splice donor site probably null
R0559:Pkdcc UTSW 17 83216025 missense probably benign 0.00
R0799:Pkdcc UTSW 17 83223918 missense probably damaging 1.00
R1512:Pkdcc UTSW 17 83220044 missense possibly damaging 0.88
R2484:Pkdcc UTSW 17 83222238 splice site probably benign
R2916:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R2918:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R3120:Pkdcc UTSW 17 83220037 missense probably damaging 1.00
R3794:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R3795:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R4433:Pkdcc UTSW 17 83221141 missense probably benign 0.02
R4689:Pkdcc UTSW 17 83215861 missense probably damaging 1.00
R5239:Pkdcc UTSW 17 83215984 missense probably damaging 1.00
R5580:Pkdcc UTSW 17 83220082 missense probably damaging 0.96
R5654:Pkdcc UTSW 17 83215908 missense probably damaging 1.00
R5739:Pkdcc UTSW 17 83215794 missense probably benign 0.44
R6456:Pkdcc UTSW 17 83220119 missense probably damaging 1.00
R7046:Pkdcc UTSW 17 83224258 missense probably damaging 0.97
R7050:Pkdcc UTSW 17 83215644 missense possibly damaging 0.46
R8557:Pkdcc UTSW 17 83221066 missense probably benign 0.02
R8833:Pkdcc UTSW 17 83223926 missense probably damaging 0.99
R9104:Pkdcc UTSW 17 83221042 missense probably damaging 1.00
Z1088:Pkdcc UTSW 17 83222150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACCCGTACACATCGGATTACC -3'
(R):5'- GCTCAAGGCAAATGCTTGCTGTTTC -3'

Sequencing Primer
(F):5'- GTACACATCGGATTACCTGCCC -3'
(R):5'- GGTGGAGGTCACTCACTCATAATC -3'
Posted On 2013-05-09