Incidental Mutation 'R4733:Piezo2'
ID 359020
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 042023-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4733 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63030401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2149 (A2149T)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: A2149T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: A2149T

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132576
Predicted Effect probably benign
Transcript: ENSMUST00000137141
SMART Domains Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 235 409 4.6e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 180 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,173 noncoding transcript Het
3110035E14Rik T C 1: 9,606,976 S24P probably benign Het
4933409G03Rik A G 2: 68,614,721 probably benign Het
Acan T C 7: 79,098,609 S1043P probably damaging Het
Ackr2 A G 9: 121,909,183 Y208C probably damaging Het
Adam1a T A 5: 121,519,434 T599S probably benign Het
Adamts12 A T 15: 11,270,662 S668C probably damaging Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Adgrf2 A C 17: 42,710,754 I393S probably damaging Het
Ahnak G T 19: 9,007,301 G1983V probably damaging Het
Aim2 T A 1: 173,463,876 D282E possibly damaging Het
Ak8 A G 2: 28,760,071 Y370C probably damaging Het
Akap9 A G 5: 4,013,901 D1750G probably damaging Het
Als2cl T A 9: 110,889,136 V315E probably damaging Het
Ankrd28 A C 14: 31,755,741 C115G probably benign Het
Ap3b2 C T 7: 81,471,932 A519T probably damaging Het
Apool C T X: 112,372,200 T166I probably damaging Het
Arhgef2 A T 3: 88,631,940 K65* probably null Het
Arhgef38 G T 3: 133,132,269 Y633* probably null Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atf7ip2 A G 16: 10,241,886 D430G possibly damaging Het
Atp8a1 G A 5: 67,813,120 S92L probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC024978 T A 7: 27,201,043 M149K probably damaging Het
C130073F10Rik C A 4: 101,890,710 S89I probably benign Het
Cacna1g T C 11: 94,443,215 T867A probably damaging Het
Ccdc88a T G 11: 29,485,906 N1276K probably benign Het
Cdc42bpg T A 19: 6,311,191 V282E probably damaging Het
Cdipt T A 7: 126,978,358 L92H probably damaging Het
Celsr2 T A 3: 108,398,952 D2012V probably damaging Het
Cenpt A G 8: 105,847,136 V254A probably benign Het
Cep104 T A 4: 153,988,426 D380E probably damaging Het
Cers5 C T 15: 99,741,637 R123Q probably benign Het
Ces2h A G 8: 105,014,604 E76G probably damaging Het
Cfap77 T A 2: 28,984,388 E143D probably benign Het
Chmp7 C A 14: 69,732,296 R65L probably damaging Het
Cldnd2 T A 7: 43,442,189 C65S possibly damaging Het
Clec2g C A 6: 128,981,879 Y142* probably null Het
Coch A T 12: 51,605,019 E549V probably benign Het
Cog7 T C 7: 121,964,244 D215G probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Col4a2 A G 8: 11,446,197 H1606R probably benign Het
Cpd T C 11: 76,811,794 N583D probably damaging Het
Cyp2d11 T A 15: 82,389,227 Y481F probably benign Het
D130043K22Rik T C 13: 24,899,665 S1038P probably damaging Het
Deptor C A 15: 55,181,010 H191N probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dnah12 C T 14: 26,781,784 T1653I probably damaging Het
Dnah7c T A 1: 46,770,173 N3550K probably damaging Het
Dnah8 A G 17: 30,775,061 K3384R probably null Het
Dnhd1 C A 7: 105,673,849 N521K probably benign Het
Drg2 T C 11: 60,461,396 probably null Het
Dync1h1 C T 12: 110,649,507 Q3030* probably null Het
Efhb G A 17: 53,426,244 T533I probably damaging Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Etfb T C 7: 43,444,200 V17A probably damaging Het
F5 C T 1: 164,181,657 T332M probably damaging Het
Fcho1 T C 8: 71,716,795 T156A probably benign Het
Fn1 A T 1: 71,602,512 probably null Het
Fnip2 A T 3: 79,481,652 S561T probably damaging Het
Frs2 T A 10: 117,074,093 T455S probably benign Het
Fry G A 5: 150,386,007 E639K Het
Fto T A 8: 91,409,714 D205E probably damaging Het
Galntl6 G A 8: 58,427,813 P147L probably damaging Het
Gigyf1 T A 5: 137,524,770 D844E probably benign Het
Gle1 T C 2: 29,940,232 S267P probably damaging Het
Glg1 G A 8: 111,187,755 R466W probably damaging Het
Gm10277 T C 11: 77,786,097 probably benign Het
Gm5724 A T 6: 141,723,179 M509K probably benign Het
Gm6871 T C 7: 41,546,749 I39V probably benign Het
Gpr35 T G 1: 92,983,385 I57S probably damaging Het
Gprin1 C T 13: 54,739,957 G168E possibly damaging Het
Gtf3c2 G T 5: 31,160,057 P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 H410L probably benign Het
Gucy2c A G 6: 136,767,152 S150P probably damaging Het
Ifi214 T C 1: 173,526,591 Q171R probably benign Het
Igkv4-50 T C 6: 69,701,000 K40R probably benign Het
Igkv8-18 T A 6: 70,356,296 I74N probably damaging Het
Il2ra T A 2: 11,676,920 M112K probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kbtbd7 T C 14: 79,428,800 *691Q probably null Het
Kcnn2 T A 18: 45,560,349 S331T possibly damaging Het
Khnyn T A 14: 55,886,489 probably null Het
Kif26a G A 12: 112,175,573 A754T probably benign Het
Klra3 T A 6: 130,327,132 Y199F possibly damaging Het
Lhx2 A G 2: 38,359,991 K274R probably damaging Het
Lrp2 T C 2: 69,533,555 I313V probably benign Het
Lrrfip1 A T 1: 91,115,647 E591D probably benign Het
Lrrk2 A C 15: 91,688,849 E200A probably damaging Het
Lrrk2 G A 15: 91,765,747 E1696K probably damaging Het
Mast4 A T 13: 102,772,572 M465K probably damaging Het
Moxd2 T G 6: 40,878,859 I599L probably benign Het
Mug2 T C 6: 122,071,872 S866P probably damaging Het
Ncam2 A G 16: 81,434,884 T79A possibly damaging Het
Ncoa6 C A 2: 155,421,301 Q404H probably damaging Het
Neb A G 2: 52,279,079 Y1815H probably damaging Het
Nell1 A G 7: 50,856,217 D724G probably damaging Het
Nkx3-2 A G 5: 41,762,144 V167A probably benign Het
Nsun3 C A 16: 62,735,119 C348F possibly damaging Het
Obox6 A T 7: 15,834,772 S60T possibly damaging Het
Olfr1 T C 11: 73,395,695 D109G probably benign Het
Olfr1378 G A 11: 50,969,266 V83M possibly damaging Het
Olfr138 T A 17: 38,275,547 Y259N probably damaging Het
Olfr466 T C 13: 65,152,653 V143A possibly damaging Het
Olfr744 T A 14: 50,618,569 C116S probably benign Het
Olfr94 T C 17: 37,197,024 T315A probably damaging Het
Olfr980 A T 9: 40,006,268 I227N probably damaging Het
Pabpc1 A T 15: 36,599,284 V389E probably benign Het
Pank4 A T 4: 154,971,390 M291L probably benign Het
Pcf11 T C 7: 92,658,833 D709G probably benign Het
Pcgf1 T A 6: 83,079,957 probably benign Het
Pcnx A G 12: 81,995,751 I2256V probably benign Het
Pex6 A G 17: 46,722,288 D579G probably benign Het
Pex6 A G 17: 46,724,707 probably null Het
Pik3c2g A G 6: 139,935,985 E781G probably benign Het
Pik3r4 G A 9: 105,678,176 V1111I possibly damaging Het
Pkd1l2 T A 8: 116,995,842 probably null Het
Plekhg1 T A 10: 3,957,506 S808T probably benign Het
Polr3c A T 3: 96,723,661 F148I probably damaging Het
Ppard A T 17: 28,286,443 T35S probably benign Het
Ptov1 T C 7: 44,867,109 D134G probably benign Het
Ptprz1 T A 6: 23,002,610 S1566R probably benign Het
Pum1 T C 4: 130,718,193 S158P probably benign Het
Qk T C 17: 10,216,288 H269R probably damaging Het
Qrsl1 T C 10: 43,876,663 Y388C probably damaging Het
Rapgef1 T G 2: 29,689,160 I182S probably damaging Het
Ret T C 6: 118,163,193 S1013G possibly damaging Het
Rimbp3 A G 16: 17,210,601 R630G possibly damaging Het
Ryr2 A T 13: 11,577,909 M4653K possibly damaging Het
Sacm1l G A 9: 123,590,830 V553I probably benign Het
Sec31b A T 19: 44,532,677 S110T probably damaging Het
Serpina3k G A 12: 104,340,860 G117D probably damaging Het
Sesn2 T C 4: 132,494,591 Y410C probably damaging Het
Slc24a1 G A 9: 64,949,554 R24C probably benign Het
Slc35g2 A C 9: 100,552,502 V372G probably benign Het
Slc7a7 T C 14: 54,408,733 Y91C probably damaging Het
Slc7a9 T A 7: 35,453,563 Y135* probably null Het
Slco4a1 A G 2: 180,473,615 N662D probably damaging Het
Slfn4 T A 11: 83,189,282 probably benign Het
Slmap T C 14: 26,468,535 N156S probably damaging Het
Snx18 A G 13: 113,617,774 S208P probably benign Het
Sorbs1 T A 19: 40,314,689 R485S probably benign Het
Spib A G 7: 44,528,885 S154P probably damaging Het
Spty2d1 T C 7: 46,996,110 D595G probably damaging Het
St7 T A 6: 17,906,516 probably null Het
Susd1 T C 4: 59,428,029 T52A possibly damaging Het
Svs2 T A 2: 164,237,123 D288V possibly damaging Het
Syt7 T A 19: 10,442,924 I355N probably damaging Het
Tarm1 G A 7: 3,496,900 Q145* probably null Het
Teddm2 T A 1: 153,850,741 E76V probably damaging Het
Thsd7b T C 1: 129,613,186 S343P probably damaging Het
Tigd2 T A 6: 59,211,415 H422Q probably benign Het
Tle1 T C 4: 72,125,019 N538D possibly damaging Het
Tmc2 A G 2: 130,261,397 probably null Het
Tmtc1 A C 6: 148,284,980 probably null Het
Tns3 C T 11: 8,450,986 R1104H probably benign Het
Trim6 T C 7: 104,232,648 Y369H probably damaging Het
Triobp G A 15: 78,967,113 R489K probably damaging Het
Trpv4 T C 5: 114,622,753 D732G possibly damaging Het
Trrap G A 5: 144,816,570 V1883I probably damaging Het
Tsc2 C A 17: 24,603,275 V1141F possibly damaging Het
Ttn A G 2: 76,899,827 probably benign Het
Ttn A T 2: 76,943,011 M2395K unknown Het
Tyrp1 A T 4: 80,844,935 D353V possibly damaging Het
Ubd A C 17: 37,195,702 T160P probably benign Het
Ugt2b36 G T 5: 87,081,538 Y156* probably null Het
Ulk4 G A 9: 121,263,638 R178* probably null Het
Unc13d A G 11: 116,073,582 V312A possibly damaging Het
Urb2 G T 8: 124,028,897 A448S probably damaging Het
Urod G A 4: 116,991,673 A92V possibly damaging Het
Vmn1r33 T A 6: 66,611,819 R250S probably benign Het
Vmn1r87 A T 7: 13,132,327 M11K possibly damaging Het
Vmn2r77 C T 7: 86,800,987 T147I probably benign Het
Vstm4 A G 14: 32,917,902 K96E possibly damaging Het
Washc4 A T 10: 83,574,479 M644L probably benign Het
Wwp1 T C 4: 19,661,990 D172G probably benign Het
Zbtb38 A T 9: 96,687,684 V449E probably damaging Het
Zfp229 C T 17: 21,745,286 H166Y possibly damaging Het
Zfp512b A G 2: 181,588,739 S453P probably benign Het
Zp2 C A 7: 120,138,120 V282L probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
sopranino UTSW 18 63024466 missense probably damaging 1.00
woodwind UTSW 18 63124642 missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
R7835:Piezo2 UTSW 18 63082945 missense probably benign 0.12
R8014:Piezo2 UTSW 18 63083200 missense probably benign 0.02
R8055:Piezo2 UTSW 18 63042811 missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63030466 missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63075730 missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63012786 missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63084688 missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63045540 missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63146802 missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63092900 nonsense probably null
R8708:Piezo2 UTSW 18 63093015 missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63109885 missense probably benign
R8727:Piezo2 UTSW 18 63109885 missense probably benign
R8810:Piezo2 UTSW 18 63114963 missense probably benign 0.41
R8900:Piezo2 UTSW 18 63115025 missense probably benign 0.04
R9037:Piezo2 UTSW 18 63092831 missense probably benign 0.31
R9079:Piezo2 UTSW 18 63024466 missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9125:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9171:Piezo2 UTSW 18 63045479 missense probably benign 0.04
R9194:Piezo2 UTSW 18 63117744 missense probably benign 0.03
R9203:Piezo2 UTSW 18 63157231 missense probably benign 0.00
R9209:Piezo2 UTSW 18 63021301 missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63075797 missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63024566 missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63029085 missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63102165 missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCAATGAGACTATGTGGGGC -3'
(R):5'- TTGAATGTTGGAAGGGACACTG -3'

Sequencing Primer
(F):5'- AGACTATGTGGGGCTCATTTCAACC -3'
(R):5'- TGGCCCACCCAAGATGCTAG -3'
Posted On 2015-11-11