Incidental Mutation 'R4733:Piezo2'
ID 359020
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik
MMRRC Submission 042023-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4733 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63143284-63520254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63163472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 2149 (A2149T)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: A2149T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: A2149T

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132576
Predicted Effect probably benign
Transcript: ENSMUST00000137141
SMART Domains Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 235 409 4.6e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 180 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,174 (GRCm39) noncoding transcript Het
4933409G03Rik A G 2: 68,445,065 (GRCm39) probably benign Het
Acan T C 7: 78,748,357 (GRCm39) S1043P probably damaging Het
Ackr2 A G 9: 121,738,249 (GRCm39) Y208C probably damaging Het
Actmap T A 7: 26,900,468 (GRCm39) M149K probably damaging Het
Adam1a T A 5: 121,657,497 (GRCm39) T599S probably benign Het
Adamts12 A T 15: 11,270,748 (GRCm39) S668C probably damaging Het
Adcy8 A G 15: 64,626,711 (GRCm39) V709A possibly damaging Het
Adgrf2 A C 17: 43,021,645 (GRCm39) I393S probably damaging Het
Ahnak G T 19: 8,984,665 (GRCm39) G1983V probably damaging Het
Aim2 T A 1: 173,291,442 (GRCm39) D282E possibly damaging Het
Ak8 A G 2: 28,650,083 (GRCm39) Y370C probably damaging Het
Akap9 A G 5: 4,063,901 (GRCm39) D1750G probably damaging Het
Als2cl T A 9: 110,718,204 (GRCm39) V315E probably damaging Het
Ankrd28 A C 14: 31,477,698 (GRCm39) C115G probably benign Het
Ap3b2 C T 7: 81,121,680 (GRCm39) A519T probably damaging Het
Apool C T X: 111,281,897 (GRCm39) T166I probably damaging Het
Arhgef2 A T 3: 88,539,247 (GRCm39) K65* probably null Het
Arhgef38 G T 3: 132,838,030 (GRCm39) Y633* probably null Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atf7ip2 A G 16: 10,059,750 (GRCm39) D430G possibly damaging Het
Atp8a1 G A 5: 67,970,463 (GRCm39) S92L probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
C130073F10Rik C A 4: 101,747,907 (GRCm39) S89I probably benign Het
Cacna1g T C 11: 94,334,041 (GRCm39) T867A probably damaging Het
Ccdc88a T G 11: 29,435,906 (GRCm39) N1276K probably benign Het
Cdc42bpg T A 19: 6,361,221 (GRCm39) V282E probably damaging Het
Cdipt T A 7: 126,577,530 (GRCm39) L92H probably damaging Het
Celsr2 T A 3: 108,306,268 (GRCm39) D2012V probably damaging Het
Cenpt A G 8: 106,573,768 (GRCm39) V254A probably benign Het
Cep104 T A 4: 154,072,883 (GRCm39) D380E probably damaging Het
Cers5 C T 15: 99,639,518 (GRCm39) R123Q probably benign Het
Ces2h A G 8: 105,741,236 (GRCm39) E76G probably damaging Het
Cfap77 T A 2: 28,874,400 (GRCm39) E143D probably benign Het
Chmp7 C A 14: 69,969,745 (GRCm39) R65L probably damaging Het
Cldnd2 T A 7: 43,091,613 (GRCm39) C65S possibly damaging Het
Clec2g C A 6: 128,958,842 (GRCm39) Y142* probably null Het
Coch A T 12: 51,651,802 (GRCm39) E549V probably benign Het
Cog7 T C 7: 121,563,467 (GRCm39) D215G probably benign Het
Col4a2 A G 8: 11,496,197 (GRCm39) H1606R probably benign Het
Col4a2 T C 8: 11,464,779 (GRCm39) V348A probably benign Het
Cpd T C 11: 76,702,620 (GRCm39) N583D probably damaging Het
Cyp2d11 T A 15: 82,273,428 (GRCm39) Y481F probably benign Het
D130043K22Rik T C 13: 25,083,648 (GRCm39) S1038P probably damaging Het
Deptor C A 15: 55,044,406 (GRCm39) H191N probably benign Het
Dgkz A T 2: 91,768,684 (GRCm39) I699N probably damaging Het
Dnah12 C T 14: 26,503,741 (GRCm39) T1653I probably damaging Het
Dnah7c T A 1: 46,809,333 (GRCm39) N3550K probably damaging Het
Dnah8 A G 17: 30,994,035 (GRCm39) K3384R probably null Het
Dnhd1 C A 7: 105,323,056 (GRCm39) N521K probably benign Het
Drg2 T C 11: 60,352,222 (GRCm39) probably null Het
Dync1h1 C T 12: 110,615,941 (GRCm39) Q3030* probably null Het
Efhb G A 17: 53,733,272 (GRCm39) T533I probably damaging Het
Eif2d T C 1: 131,092,464 (GRCm39) V374A probably damaging Het
Etfb T C 7: 43,093,624 (GRCm39) V17A probably damaging Het
F5 C T 1: 164,009,226 (GRCm39) T332M probably damaging Het
Fcho1 T C 8: 72,169,439 (GRCm39) T156A probably benign Het
Fn1 A T 1: 71,641,671 (GRCm39) probably null Het
Fnip2 A T 3: 79,388,959 (GRCm39) S561T probably damaging Het
Frs2 T A 10: 116,909,998 (GRCm39) T455S probably benign Het
Fry G A 5: 150,309,472 (GRCm39) E639K Het
Fto T A 8: 92,136,342 (GRCm39) D205E probably damaging Het
Galntl6 G A 8: 58,880,847 (GRCm39) P147L probably damaging Het
Gigyf1 T A 5: 137,523,032 (GRCm39) D844E probably benign Het
Gle1 T C 2: 29,830,244 (GRCm39) S267P probably damaging Het
Glg1 G A 8: 111,914,387 (GRCm39) R466W probably damaging Het
Gm10277 T C 11: 77,676,923 (GRCm39) probably benign Het
Gm6871 T C 7: 41,196,173 (GRCm39) I39V probably benign Het
Gpr35 T G 1: 92,911,107 (GRCm39) I57S probably damaging Het
Gprin1 C T 13: 54,887,770 (GRCm39) G168E possibly damaging Het
Gtf3c2 G T 5: 31,317,401 (GRCm39) P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 (GRCm39) H410L probably benign Het
Gucy2c A G 6: 136,744,150 (GRCm39) S150P probably damaging Het
Ifi214 T C 1: 173,354,157 (GRCm39) Q171R probably benign Het
Igkv4-50 T C 6: 69,677,984 (GRCm39) K40R probably benign Het
Igkv8-18 T A 6: 70,333,280 (GRCm39) I74N probably damaging Het
Il2ra T A 2: 11,681,731 (GRCm39) M112K probably benign Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Kbtbd7 T C 14: 79,666,240 (GRCm39) *691Q probably null Het
Kcnn2 T A 18: 45,693,416 (GRCm39) S331T possibly damaging Het
Khnyn T A 14: 56,123,946 (GRCm39) probably null Het
Kif26a G A 12: 112,142,007 (GRCm39) A754T probably benign Het
Klra3 T A 6: 130,304,095 (GRCm39) Y199F possibly damaging Het
Lhx2 A G 2: 38,250,003 (GRCm39) K274R probably damaging Het
Lrp2 T C 2: 69,363,899 (GRCm39) I313V probably benign Het
Lrrfip1 A T 1: 91,043,369 (GRCm39) E591D probably benign Het
Lrrk2 G A 15: 91,649,950 (GRCm39) E1696K probably damaging Het
Lrrk2 A C 15: 91,573,052 (GRCm39) E200A probably damaging Het
Mast4 A T 13: 102,909,080 (GRCm39) M465K probably damaging Het
Moxd2 T G 6: 40,855,793 (GRCm39) I599L probably benign Het
Mug2 T C 6: 122,048,831 (GRCm39) S866P probably damaging Het
Ncam2 A G 16: 81,231,772 (GRCm39) T79A possibly damaging Het
Ncoa6 C A 2: 155,263,221 (GRCm39) Q404H probably damaging Het
Neb A G 2: 52,169,091 (GRCm39) Y1815H probably damaging Het
Nell1 A G 7: 50,505,965 (GRCm39) D724G probably damaging Het
Nkx3-2 A G 5: 41,919,487 (GRCm39) V167A probably benign Het
Nsun3 C A 16: 62,555,482 (GRCm39) C348F possibly damaging Het
Obox6 A T 7: 15,568,697 (GRCm39) S60T possibly damaging Het
Or10g9b A T 9: 39,917,564 (GRCm39) I227N probably damaging Het
Or11g2 T A 14: 50,856,026 (GRCm39) C116S probably benign Het
Or1ad6 G A 11: 50,860,093 (GRCm39) V83M possibly damaging Het
Or1e16 T C 11: 73,286,521 (GRCm39) D109G probably benign Het
Or2i1 T C 17: 37,507,915 (GRCm39) T315A probably damaging Het
Or2n1e T A 17: 38,586,438 (GRCm39) Y259N probably damaging Het
Or9s18 T C 13: 65,300,467 (GRCm39) V143A possibly damaging Het
Pabpc1 A T 15: 36,599,528 (GRCm39) V389E probably benign Het
Pank4 A T 4: 155,055,847 (GRCm39) M291L probably benign Het
Pcf11 T C 7: 92,308,041 (GRCm39) D709G probably benign Het
Pcgf1 T A 6: 83,056,938 (GRCm39) probably benign Het
Pcnx1 A G 12: 82,042,525 (GRCm39) I2256V probably benign Het
Pex6 A G 17: 47,033,214 (GRCm39) D579G probably benign Het
Pex6 A G 17: 47,035,633 (GRCm39) probably null Het
Pik3c2g A G 6: 139,881,711 (GRCm39) E781G probably benign Het
Pik3r4 G A 9: 105,555,375 (GRCm39) V1111I possibly damaging Het
Pkd1l2 T A 8: 117,722,581 (GRCm39) probably null Het
Plekhg1 T A 10: 3,907,506 (GRCm39) S808T probably benign Het
Polr3c A T 3: 96,630,977 (GRCm39) F148I probably damaging Het
Ppard A T 17: 28,505,417 (GRCm39) T35S probably benign Het
Ptov1 T C 7: 44,516,533 (GRCm39) D134G probably benign Het
Ptprz1 T A 6: 23,002,609 (GRCm39) S1566R probably benign Het
Pum1 T C 4: 130,445,504 (GRCm39) S158P probably benign Het
Qki T C 17: 10,435,217 (GRCm39) H269R probably damaging Het
Qrsl1 T C 10: 43,752,659 (GRCm39) Y388C probably damaging Het
Rapgef1 T G 2: 29,579,172 (GRCm39) I182S probably damaging Het
Ret T C 6: 118,140,154 (GRCm39) S1013G possibly damaging Het
Rimbp3 A G 16: 17,028,465 (GRCm39) R630G possibly damaging Het
Ryr2 A T 13: 11,592,795 (GRCm39) M4653K possibly damaging Het
Sacm1l G A 9: 123,419,895 (GRCm39) V553I probably benign Het
Sec31b A T 19: 44,521,116 (GRCm39) S110T probably damaging Het
Serpina3k G A 12: 104,307,119 (GRCm39) G117D probably damaging Het
Sesn2 T C 4: 132,221,902 (GRCm39) Y410C probably damaging Het
Slc24a1 G A 9: 64,856,836 (GRCm39) R24C probably benign Het
Slc35g2 A C 9: 100,434,555 (GRCm39) V372G probably benign Het
Slc7a7 T C 14: 54,646,190 (GRCm39) Y91C probably damaging Het
Slc7a9 T A 7: 35,152,988 (GRCm39) Y135* probably null Het
Slco1a7 A T 6: 141,668,905 (GRCm39) M509K probably benign Het
Slco4a1 A G 2: 180,115,408 (GRCm39) N662D probably damaging Het
Slfn4 T A 11: 83,080,108 (GRCm39) probably benign Het
Slmap T C 14: 26,189,690 (GRCm39) N156S probably damaging Het
Snx18 A G 13: 113,754,310 (GRCm39) S208P probably benign Het
Sorbs1 T A 19: 40,303,133 (GRCm39) R485S probably benign Het
Spib A G 7: 44,178,309 (GRCm39) S154P probably damaging Het
Spty2d1 T C 7: 46,645,858 (GRCm39) D595G probably damaging Het
St7 T A 6: 17,906,515 (GRCm39) probably null Het
Susd1 T C 4: 59,428,029 (GRCm39) T52A possibly damaging Het
Svs5 T A 2: 164,079,043 (GRCm39) D288V possibly damaging Het
Syt7 T A 19: 10,420,288 (GRCm39) I355N probably damaging Het
Tarm1 G A 7: 3,545,416 (GRCm39) Q145* probably null Het
Teddm2 T A 1: 153,726,487 (GRCm39) E76V probably damaging Het
Thsd7b T C 1: 129,540,923 (GRCm39) S343P probably damaging Het
Tigd2 T A 6: 59,188,400 (GRCm39) H422Q probably benign Het
Tle1 T C 4: 72,043,256 (GRCm39) N538D possibly damaging Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmtc1 A C 6: 148,186,478 (GRCm39) probably null Het
Tns3 C T 11: 8,400,986 (GRCm39) R1104H probably benign Het
Trim6 T C 7: 103,881,855 (GRCm39) Y369H probably damaging Het
Triobp G A 15: 78,851,313 (GRCm39) R489K probably damaging Het
Trpv4 T C 5: 114,760,814 (GRCm39) D732G possibly damaging Het
Trrap G A 5: 144,753,380 (GRCm39) V1883I probably damaging Het
Tsc2 C A 17: 24,822,249 (GRCm39) V1141F possibly damaging Het
Ttn A T 2: 76,773,355 (GRCm39) M2395K unknown Het
Ttn A G 2: 76,730,171 (GRCm39) probably benign Het
Tyrp1 A T 4: 80,763,172 (GRCm39) D353V possibly damaging Het
Ubd A C 17: 37,506,593 (GRCm39) T160P probably benign Het
Ugt2b36 G T 5: 87,229,397 (GRCm39) Y156* probably null Het
Ulk4 G A 9: 121,092,704 (GRCm39) R178* probably null Het
Unc13d A G 11: 115,964,408 (GRCm39) V312A possibly damaging Het
Urb2 G T 8: 124,755,636 (GRCm39) A448S probably damaging Het
Urod G A 4: 116,848,870 (GRCm39) A92V possibly damaging Het
Vmn1r33 T A 6: 66,588,803 (GRCm39) R250S probably benign Het
Vmn1r87 A T 7: 12,866,254 (GRCm39) M11K possibly damaging Het
Vmn2r77 C T 7: 86,450,195 (GRCm39) T147I probably benign Het
Vstm4 A G 14: 32,639,859 (GRCm39) K96E possibly damaging Het
Vxn T C 1: 9,677,201 (GRCm39) S24P probably benign Het
Washc4 A T 10: 83,410,343 (GRCm39) M644L probably benign Het
Wwp1 T C 4: 19,661,990 (GRCm39) D172G probably benign Het
Zbtb38 A T 9: 96,569,737 (GRCm39) V449E probably damaging Het
Zfp229 C T 17: 21,964,267 (GRCm39) H166Y possibly damaging Het
Zfp512b A G 2: 181,230,532 (GRCm39) S453P probably benign Het
Zp2 C A 7: 119,737,343 (GRCm39) V282L probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63,250,770 (GRCm39) missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63,155,531 (GRCm39) missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63,203,101 (GRCm39) missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63,257,685 (GRCm39) missense probably benign 0.03
IGL01568:Piezo2 APN 18 63,163,463 (GRCm39) missense probably benign 0.28
IGL01653:Piezo2 APN 18 63,315,904 (GRCm39) splice site probably benign
IGL01674:Piezo2 APN 18 63,160,630 (GRCm39) missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63,216,241 (GRCm39) missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63,175,859 (GRCm39) missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63,225,915 (GRCm39) missense probably benign 0.10
IGL02183:Piezo2 APN 18 63,153,705 (GRCm39) missense probably benign 0.00
IGL02407:Piezo2 APN 18 63,279,915 (GRCm39) missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63,205,933 (GRCm39) missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63,165,995 (GRCm39) missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63,157,546 (GRCm39) missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63,207,730 (GRCm39) missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02851:Piezo2 APN 18 63,153,704 (GRCm39) missense probably benign 0.18
IGL02972:Piezo2 APN 18 63,197,856 (GRCm39) splice site probably benign
IGL03011:Piezo2 APN 18 63,257,731 (GRCm39) missense probably benign 0.03
IGL03078:Piezo2 APN 18 63,203,146 (GRCm39) missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63,163,343 (GRCm39) splice site probably null
IGL03129:Piezo2 APN 18 63,248,043 (GRCm39) missense probably benign
IGL03143:Piezo2 APN 18 63,241,147 (GRCm39) missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63,144,669 (GRCm39) missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63,257,677 (GRCm39) missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63,186,133 (GRCm39) missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63,174,791 (GRCm39) missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63,144,609 (GRCm39) utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63,154,379 (GRCm39) missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63,160,775 (GRCm39) missense probably damaging 1.00
Piccolo UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
sopranino UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
woodwind UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63,519,271 (GRCm39) splice site probably benign
PIT4802001:Piezo2 UTSW 18 63,157,540 (GRCm39) missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63,235,155 (GRCm39) missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63,157,562 (GRCm39) missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63,162,132 (GRCm39) missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63,235,245 (GRCm39) missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63,157,522 (GRCm39) missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63,160,615 (GRCm39) missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63,155,552 (GRCm39) missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63,155,497 (GRCm39) missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63,152,329 (GRCm39) missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63,174,794 (GRCm39) missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63,216,306 (GRCm39) missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63,148,873 (GRCm39) missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63,219,824 (GRCm39) missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63,154,325 (GRCm39) missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63,216,202 (GRCm39) missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63,277,990 (GRCm39) missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63,215,986 (GRCm39) missense probably benign 0.03
R1649:Piezo2 UTSW 18 63,250,743 (GRCm39) missense probably benign 0.34
R1741:Piezo2 UTSW 18 63,154,244 (GRCm39) missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63,257,713 (GRCm39) missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63,239,355 (GRCm39) missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63,241,158 (GRCm39) missense probably damaging 1.00
R1799:Piezo2 UTSW 18 63,165,911 (GRCm39) critical splice donor site probably null
R1868:Piezo2 UTSW 18 63,152,415 (GRCm39) missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63,247,031 (GRCm39) missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63,211,911 (GRCm39) missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1991:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1992:Piezo2 UTSW 18 63,207,733 (GRCm39) missense probably null 1.00
R1995:Piezo2 UTSW 18 63,211,852 (GRCm39) missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63,277,997 (GRCm39) missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63,192,815 (GRCm39) missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63,252,006 (GRCm39) missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63,214,805 (GRCm39) missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63,250,791 (GRCm39) missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63,247,112 (GRCm39) missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R2183:Piezo2 UTSW 18 63,239,345 (GRCm39) missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63,278,143 (GRCm39) missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63,155,596 (GRCm39) missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63,378,695 (GRCm39) missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63,186,106 (GRCm39) missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63,279,914 (GRCm39) missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63,157,506 (GRCm39) nonsense probably null
R3016:Piezo2 UTSW 18 63,175,903 (GRCm39) missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63,214,864 (GRCm39) missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3833:Piezo2 UTSW 18 63,214,733 (GRCm39) critical splice donor site probably null
R3968:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63,144,767 (GRCm39) missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63,183,675 (GRCm39) missense probably benign
R4181:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63,217,911 (GRCm39) missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63,257,801 (GRCm39) critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63,235,170 (GRCm39) missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63,247,134 (GRCm39) missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63,205,951 (GRCm39) missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63,219,699 (GRCm39) missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63,203,034 (GRCm39) missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63,163,472 (GRCm39) missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63,278,025 (GRCm39) missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63,211,862 (GRCm39) missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63,290,333 (GRCm39) missense probably benign
R4961:Piezo2 UTSW 18 63,186,032 (GRCm39) splice site probably null
R4968:Piezo2 UTSW 18 63,278,042 (GRCm39) nonsense probably null
R4973:Piezo2 UTSW 18 63,207,751 (GRCm39) missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63,216,184 (GRCm39) missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63,157,607 (GRCm39) missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63,207,691 (GRCm39) missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63,163,480 (GRCm39) missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63,166,000 (GRCm39) missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63,197,802 (GRCm39) missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63,217,811 (GRCm39) missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63,278,176 (GRCm39) missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63,160,935 (GRCm39) missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63,144,792 (GRCm39) missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63,278,162 (GRCm39) missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63,250,768 (GRCm39) missense probably benign 0.25
R5677:Piezo2 UTSW 18 63,250,767 (GRCm39) missense possibly damaging 0.94
R5792:Piezo2 UTSW 18 63,279,927 (GRCm39) missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63,160,972 (GRCm39) missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63,247,005 (GRCm39) missense probably benign 0.22
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6036:Piezo2 UTSW 18 63,248,019 (GRCm39) nonsense probably null
R6073:Piezo2 UTSW 18 63,145,716 (GRCm39) missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63,290,281 (GRCm39) nonsense probably null
R6255:Piezo2 UTSW 18 63,254,341 (GRCm39) missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63,250,749 (GRCm39) missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63,239,364 (GRCm39) missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63,219,678 (GRCm39) missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63,174,734 (GRCm39) missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63,239,342 (GRCm39) missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63,154,399 (GRCm39) missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63,154,333 (GRCm39) missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63,165,960 (GRCm39) nonsense probably null
R6855:Piezo2 UTSW 18 63,223,950 (GRCm39) critical splice donor site probably null
R6927:Piezo2 UTSW 18 63,166,057 (GRCm39) missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63,216,032 (GRCm39) critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63,278,181 (GRCm39) nonsense probably null
R7162:Piezo2 UTSW 18 63,257,780 (GRCm39) missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63,241,101 (GRCm39) missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63,150,590 (GRCm39) splice site probably null
R7395:Piezo2 UTSW 18 63,160,634 (GRCm39) missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63,157,543 (GRCm39) missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63,145,794 (GRCm39) missense probably benign
R7517:Piezo2 UTSW 18 63,215,996 (GRCm39) missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63,186,081 (GRCm39) missense probably benign 0.01
R7612:Piezo2 UTSW 18 63,175,610 (GRCm39) missense probably benign 0.12
R7829:Piezo2 UTSW 18 63,246,947 (GRCm39) critical splice donor site probably null
R7835:Piezo2 UTSW 18 63,216,016 (GRCm39) missense probably benign 0.12
R8014:Piezo2 UTSW 18 63,216,271 (GRCm39) missense probably benign 0.02
R8055:Piezo2 UTSW 18 63,175,882 (GRCm39) missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63,163,537 (GRCm39) missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63,208,801 (GRCm39) missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63,145,857 (GRCm39) missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63,217,759 (GRCm39) missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63,224,069 (GRCm39) missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63,178,611 (GRCm39) missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63,279,873 (GRCm39) missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63,225,971 (GRCm39) nonsense probably null
R8708:Piezo2 UTSW 18 63,226,086 (GRCm39) missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8727:Piezo2 UTSW 18 63,242,956 (GRCm39) missense probably benign
R8810:Piezo2 UTSW 18 63,248,034 (GRCm39) missense probably benign 0.41
R8900:Piezo2 UTSW 18 63,248,096 (GRCm39) missense probably benign 0.04
R9037:Piezo2 UTSW 18 63,225,902 (GRCm39) missense probably benign 0.31
R9079:Piezo2 UTSW 18 63,157,537 (GRCm39) missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9125:Piezo2 UTSW 18 63,178,589 (GRCm39) missense probably benign 0.00
R9171:Piezo2 UTSW 18 63,178,550 (GRCm39) missense probably benign 0.04
R9194:Piezo2 UTSW 18 63,250,815 (GRCm39) missense probably benign 0.03
R9203:Piezo2 UTSW 18 63,290,302 (GRCm39) missense probably benign 0.00
R9209:Piezo2 UTSW 18 63,154,372 (GRCm39) missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63,208,868 (GRCm39) missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63,163,450 (GRCm39) missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63,208,790 (GRCm39) missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63,157,637 (GRCm39) missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63,162,156 (GRCm39) missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63,235,236 (GRCm39) missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63,166,033 (GRCm39) missense possibly damaging 0.67
R9607:Piezo2 UTSW 18 63,519,347 (GRCm39) start gained probably benign
R9608:Piezo2 UTSW 18 63,280,016 (GRCm39) missense probably benign 0.09
R9617:Piezo2 UTSW 18 63,248,108 (GRCm39) missense probably benign 0.43
R9624:Piezo2 UTSW 18 63,197,767 (GRCm39) missense possibly damaging 0.88
X0017:Piezo2 UTSW 18 63,160,657 (GRCm39) missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63,183,681 (GRCm39) missense probably benign 0.43
X0060:Piezo2 UTSW 18 63,150,648 (GRCm39) missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63,203,065 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATCAATGAGACTATGTGGGGC -3'
(R):5'- TTGAATGTTGGAAGGGACACTG -3'

Sequencing Primer
(F):5'- AGACTATGTGGGGCTCATTTCAACC -3'
(R):5'- TGGCCCACCCAAGATGCTAG -3'
Posted On 2015-11-11