Incidental Mutation 'R4732:Vmn2r77'
ID 359074
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Name vomeronasal 2, receptor 77
Synonyms EG546983
MMRRC Submission 042022-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4732 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86444349-86461240 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86450195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 147 (T147I)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
AlphaFold L7N2B7
Predicted Effect probably benign
Transcript: ENSMUST00000164996
AA Change: T147I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: T147I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (110/111)
Allele List at MGI
Other mutations in this stock
Total: 192 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik T A 9: 8,222,174 (GRCm39) noncoding transcript Het
4933409G03Rik A G 2: 68,445,065 (GRCm39) probably benign Het
Acan T C 7: 78,748,357 (GRCm39) S1043P probably damaging Het
Ackr2 A G 9: 121,738,249 (GRCm39) Y208C probably damaging Het
Actg1 C T 11: 120,238,305 (GRCm39) probably benign Het
Actmap T A 7: 26,900,468 (GRCm39) M149K probably damaging Het
Adam1a T A 5: 121,657,497 (GRCm39) T599S probably benign Het
Adamts12 A T 15: 11,270,748 (GRCm39) S668C probably damaging Het
Adcy8 A G 15: 64,626,711 (GRCm39) V709A possibly damaging Het
Adgrf2 A C 17: 43,021,645 (GRCm39) I393S probably damaging Het
Ahnak G T 19: 8,984,665 (GRCm39) G1983V probably damaging Het
Aim2 T A 1: 173,291,442 (GRCm39) D282E possibly damaging Het
Ak8 A G 2: 28,650,083 (GRCm39) Y370C probably damaging Het
Akap9 A G 5: 4,063,901 (GRCm39) D1750G probably damaging Het
Als2cl T A 9: 110,718,204 (GRCm39) V315E probably damaging Het
Ankrd28 A C 14: 31,477,698 (GRCm39) C115G probably benign Het
Ap3b2 C T 7: 81,121,680 (GRCm39) A519T probably damaging Het
Apool C T X: 111,281,897 (GRCm39) T166I probably damaging Het
Arhgef2 A T 3: 88,539,247 (GRCm39) K65* probably null Het
Arhgef38 G T 3: 132,838,030 (GRCm39) Y633* probably null Het
Asah2 T C 19: 31,972,758 (GRCm39) N659S probably benign Het
Atf7ip2 A G 16: 10,059,750 (GRCm39) D430G possibly damaging Het
Atp8a1 G A 5: 67,970,463 (GRCm39) S92L probably benign Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
C130073F10Rik C A 4: 101,747,907 (GRCm39) S89I probably benign Het
Cacna1g T C 11: 94,334,041 (GRCm39) T867A probably damaging Het
Ccdc88a T G 11: 29,435,906 (GRCm39) N1276K probably benign Het
Cdc42bpg T A 19: 6,361,221 (GRCm39) V282E probably damaging Het
Cdipt T A 7: 126,577,530 (GRCm39) L92H probably damaging Het
Celsr2 T A 3: 108,306,268 (GRCm39) D2012V probably damaging Het
Cenpt A G 8: 106,573,768 (GRCm39) V254A probably benign Het
Cep104 T A 4: 154,072,883 (GRCm39) D380E probably damaging Het
Cers5 C T 15: 99,639,518 (GRCm39) R123Q probably benign Het
Ces2h A G 8: 105,741,236 (GRCm39) E76G probably damaging Het
Cfap77 T A 2: 28,874,400 (GRCm39) E143D probably benign Het
Chmp7 C A 14: 69,969,745 (GRCm39) R65L probably damaging Het
Cldnd2 T A 7: 43,091,613 (GRCm39) C65S possibly damaging Het
Clec2g C A 6: 128,958,842 (GRCm39) Y142* probably null Het
Coch A T 12: 51,651,802 (GRCm39) E549V probably benign Het
Cog7 T C 7: 121,563,467 (GRCm39) D215G probably benign Het
Col4a2 T C 8: 11,464,779 (GRCm39) V348A probably benign Het
Col4a2 A G 8: 11,496,197 (GRCm39) H1606R probably benign Het
Cpd T C 11: 76,702,620 (GRCm39) N583D probably damaging Het
Cyp2d11 T A 15: 82,273,428 (GRCm39) Y481F probably benign Het
D130043K22Rik T C 13: 25,083,648 (GRCm39) S1038P probably damaging Het
Deptor C A 15: 55,044,406 (GRCm39) H191N probably benign Het
Dgkz A T 2: 91,768,684 (GRCm39) I699N probably damaging Het
Dnah12 C T 14: 26,503,741 (GRCm39) T1653I probably damaging Het
Dnah7c T A 1: 46,809,333 (GRCm39) N3550K probably damaging Het
Dnah8 A G 17: 30,994,035 (GRCm39) K3384R probably null Het
Dnajc11 A G 4: 152,055,424 (GRCm39) probably benign Het
Dnajc13 CT C 9: 104,064,004 (GRCm39) probably benign Het
Dnhd1 C A 7: 105,323,056 (GRCm39) N521K probably benign Het
Drg2 T C 11: 60,352,222 (GRCm39) probably null Het
Dync1h1 C T 12: 110,615,941 (GRCm39) Q3030* probably null Het
Efhb G A 17: 53,733,272 (GRCm39) T533I probably damaging Het
Eif2d T C 1: 131,092,464 (GRCm39) V374A probably damaging Het
Etfb T C 7: 43,093,624 (GRCm39) V17A probably damaging Het
F5 C T 1: 164,009,226 (GRCm39) T332M probably damaging Het
Fcho1 T C 8: 72,169,439 (GRCm39) T156A probably benign Het
Fn1 A T 1: 71,641,671 (GRCm39) probably null Het
Fnip2 A T 3: 79,388,959 (GRCm39) S561T probably damaging Het
Frs2 T A 10: 116,909,998 (GRCm39) T455S probably benign Het
Fry G A 5: 150,309,472 (GRCm39) E639K Het
Fto T A 8: 92,136,342 (GRCm39) D205E probably damaging Het
Galnt2l A G 8: 122,997,013 (GRCm39) probably benign Het
Galntl6 G A 8: 58,880,847 (GRCm39) P147L probably damaging Het
Gigyf1 T A 5: 137,523,032 (GRCm39) D844E probably benign Het
Gle1 T C 2: 29,830,244 (GRCm39) S267P probably damaging Het
Glg1 G A 8: 111,914,387 (GRCm39) R466W probably damaging Het
Gm10277 T C 11: 77,676,923 (GRCm39) probably benign Het
Gm6871 T C 7: 41,196,173 (GRCm39) I39V probably benign Het
Gm9970 A G 5: 31,398,410 (GRCm39) probably benign Het
Gpr35 T G 1: 92,911,107 (GRCm39) I57S probably damaging Het
Gprin1 C T 13: 54,887,770 (GRCm39) G168E possibly damaging Het
Gtdc1 A G 2: 44,679,067 (GRCm39) probably benign Het
Gtf3c2 G T 5: 31,317,401 (GRCm39) P586T probably damaging Het
Gucy1a2 A T 9: 3,759,424 (GRCm39) H410L probably benign Het
Gucy2c A G 6: 136,744,150 (GRCm39) S150P probably damaging Het
Ifi214 T C 1: 173,354,157 (GRCm39) Q171R probably benign Het
Ifit1bl1 T C 19: 34,571,721 (GRCm39) I245M probably benign Het
Igkv4-50 T C 6: 69,677,984 (GRCm39) K40R probably benign Het
Igkv8-18 T A 6: 70,333,280 (GRCm39) I74N probably damaging Het
Il2ra T A 2: 11,681,731 (GRCm39) M112K probably benign Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
Kbtbd7 T C 14: 79,666,240 (GRCm39) *691Q probably null Het
Kcnn2 T A 18: 45,693,416 (GRCm39) S331T possibly damaging Het
Khnyn T A 14: 56,123,946 (GRCm39) probably null Het
Kif26a G A 12: 112,142,007 (GRCm39) A754T probably benign Het
Klra3 T A 6: 130,304,095 (GRCm39) Y199F possibly damaging Het
Lhx2 A G 2: 38,250,003 (GRCm39) K274R probably damaging Het
Lrp2 T C 2: 69,363,899 (GRCm39) I313V probably benign Het
Lrrfip1 A T 1: 91,043,369 (GRCm39) E591D probably benign Het
Lrrk2 A C 15: 91,573,052 (GRCm39) E200A probably damaging Het
Lrrk2 G A 15: 91,649,950 (GRCm39) E1696K probably damaging Het
Mast4 A T 13: 102,909,080 (GRCm39) M465K probably damaging Het
Moxd2 T G 6: 40,855,793 (GRCm39) I599L probably benign Het
Mug2 T C 6: 122,048,831 (GRCm39) S866P probably damaging Het
Ncam2 A G 16: 81,231,772 (GRCm39) T79A possibly damaging Het
Ncoa6 C A 2: 155,263,221 (GRCm39) Q404H probably damaging Het
Neb A G 2: 52,169,091 (GRCm39) Y1815H probably damaging Het
Nell1 A G 7: 50,505,965 (GRCm39) D724G probably damaging Het
Nkx3-2 A G 5: 41,919,487 (GRCm39) V167A probably benign Het
Nsun3 C A 16: 62,555,482 (GRCm39) C348F possibly damaging Het
Obox6 A T 7: 15,568,697 (GRCm39) S60T possibly damaging Het
Oog2 T A 4: 143,920,511 (GRCm39) probably benign Het
Or10g9b A T 9: 39,917,564 (GRCm39) I227N probably damaging Het
Or11g2 T A 14: 50,856,026 (GRCm39) C116S probably benign Het
Or1ad6 G A 11: 50,860,093 (GRCm39) V83M possibly damaging Het
Or1e16 T C 11: 73,286,521 (GRCm39) D109G probably benign Het
Or2i1 T C 17: 37,507,915 (GRCm39) T315A probably damaging Het
Or2n1e T A 17: 38,586,438 (GRCm39) Y259N probably damaging Het
Or9s18 T C 13: 65,300,467 (GRCm39) V143A possibly damaging Het
Pabpc1 A T 15: 36,599,528 (GRCm39) V389E probably benign Het
Pank4 A T 4: 155,055,847 (GRCm39) M291L probably benign Het
Pcf11 T C 7: 92,308,041 (GRCm39) D709G probably benign Het
Pcgf1 T A 6: 83,056,938 (GRCm39) probably benign Het
Pcnx1 A G 12: 82,042,525 (GRCm39) I2256V probably benign Het
Pex6 A G 17: 47,035,633 (GRCm39) probably null Het
Pex6 A G 17: 47,033,214 (GRCm39) D579G probably benign Het
Piezo2 C T 18: 63,163,472 (GRCm39) A2149T probably damaging Het
Pik3c2g A G 6: 139,881,711 (GRCm39) E781G probably benign Het
Pik3r4 G A 9: 105,555,375 (GRCm39) V1111I possibly damaging Het
Pkd1l2 T A 8: 117,722,581 (GRCm39) probably null Het
Plekhg1 T A 10: 3,907,506 (GRCm39) S808T probably benign Het
Pnkp T A 7: 44,509,878 (GRCm39) probably benign Het
Polr3c A T 3: 96,630,977 (GRCm39) F148I probably damaging Het
Ppard A T 17: 28,505,417 (GRCm39) T35S probably benign Het
Ptov1 T C 7: 44,516,533 (GRCm39) D134G probably benign Het
Ptprz1 T A 6: 23,002,609 (GRCm39) S1566R probably benign Het
Pum1 T C 4: 130,445,504 (GRCm39) S158P probably benign Het
Qki T C 17: 10,435,217 (GRCm39) H269R probably damaging Het
Qrsl1 T C 10: 43,752,659 (GRCm39) Y388C probably damaging Het
Rapgef1 T G 2: 29,579,172 (GRCm39) I182S probably damaging Het
Ret T C 6: 118,140,154 (GRCm39) S1013G possibly damaging Het
Rimbp3 A G 16: 17,028,465 (GRCm39) R630G possibly damaging Het
Rnmt A T 18: 68,451,031 (GRCm39) probably benign Het
Ryr2 A T 13: 11,592,795 (GRCm39) M4653K possibly damaging Het
Sacm1l G A 9: 123,419,895 (GRCm39) V553I probably benign Het
Sec31b A T 19: 44,521,116 (GRCm39) S110T probably damaging Het
Serpina3k G A 12: 104,307,119 (GRCm39) G117D probably damaging Het
Sesn2 T C 4: 132,221,902 (GRCm39) Y410C probably damaging Het
Slc24a1 G A 9: 64,856,836 (GRCm39) R24C probably benign Het
Slc35g2 A C 9: 100,434,555 (GRCm39) V372G probably benign Het
Slc7a7 T C 14: 54,646,190 (GRCm39) Y91C probably damaging Het
Slc7a9 T A 7: 35,152,988 (GRCm39) Y135* probably null Het
Slco1a7 A T 6: 141,668,905 (GRCm39) M509K probably benign Het
Slco4a1 A G 2: 180,115,408 (GRCm39) N662D probably damaging Het
Slfn4 T A 11: 83,080,108 (GRCm39) probably benign Het
Slmap T C 14: 26,189,690 (GRCm39) N156S probably damaging Het
Smim29 A G 17: 27,784,244 (GRCm39) probably benign Het
Snx18 A G 13: 113,754,310 (GRCm39) S208P probably benign Het
Sorbs1 T A 19: 40,303,133 (GRCm39) R485S probably benign Het
Spib A G 7: 44,178,309 (GRCm39) S154P probably damaging Het
Spty2d1 T C 7: 46,645,858 (GRCm39) D595G probably damaging Het
St7 T A 6: 17,906,515 (GRCm39) probably null Het
Susd1 T C 4: 59,428,029 (GRCm39) T52A possibly damaging Het
Svs5 T A 2: 164,079,043 (GRCm39) D288V possibly damaging Het
Syt7 T A 19: 10,420,288 (GRCm39) I355N probably damaging Het
Tarm1 G A 7: 3,545,416 (GRCm39) Q145* probably null Het
Teddm2 T A 1: 153,726,487 (GRCm39) E76V probably damaging Het
Thsd7b T C 1: 129,540,923 (GRCm39) S343P probably damaging Het
Tigd2 T A 6: 59,188,400 (GRCm39) H422Q probably benign Het
Tle1 T C 4: 72,043,256 (GRCm39) N538D possibly damaging Het
Tmc2 A G 2: 130,103,317 (GRCm39) probably null Het
Tmtc1 A C 6: 148,186,478 (GRCm39) probably null Het
Tns3 C T 11: 8,400,986 (GRCm39) R1104H probably benign Het
Trim6 T C 7: 103,881,855 (GRCm39) Y369H probably damaging Het
Triobp G A 15: 78,851,313 (GRCm39) R489K probably damaging Het
Trpv4 T C 5: 114,760,814 (GRCm39) D732G possibly damaging Het
Trrap G A 5: 144,753,380 (GRCm39) V1883I probably damaging Het
Tsc2 C A 17: 24,822,249 (GRCm39) V1141F possibly damaging Het
Ttn A G 2: 76,730,171 (GRCm39) probably benign Het
Ttn A T 2: 76,773,355 (GRCm39) M2395K unknown Het
Tyrp1 A T 4: 80,763,172 (GRCm39) D353V possibly damaging Het
Ubd A C 17: 37,506,593 (GRCm39) T160P probably benign Het
Ugt2b36 G T 5: 87,229,397 (GRCm39) Y156* probably null Het
Ulk4 G A 9: 121,092,704 (GRCm39) R178* probably null Het
Unc13d A G 11: 115,964,408 (GRCm39) V312A possibly damaging Het
Urb2 G T 8: 124,755,636 (GRCm39) A448S probably damaging Het
Urod G A 4: 116,848,870 (GRCm39) A92V possibly damaging Het
Vmn1r33 T A 6: 66,588,803 (GRCm39) R250S probably benign Het
Vmn1r87 A T 7: 12,866,254 (GRCm39) M11K possibly damaging Het
Vstm4 A G 14: 32,639,859 (GRCm39) K96E possibly damaging Het
Vxn T C 1: 9,677,201 (GRCm39) S24P probably benign Het
Washc4 A T 10: 83,410,343 (GRCm39) M644L probably benign Het
Wwp1 T C 4: 19,661,990 (GRCm39) D172G probably benign Het
Zbtb38 A T 9: 96,569,737 (GRCm39) V449E probably damaging Het
Zfhx4 T C 3: 5,279,867 (GRCm39) probably benign Het
Zfp229 C T 17: 21,964,267 (GRCm39) H166Y possibly damaging Het
Zfp512b A G 2: 181,230,532 (GRCm39) S453P probably benign Het
Zp2 C A 7: 119,737,343 (GRCm39) V282L probably damaging Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86,449,975 (GRCm39) missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86,460,872 (GRCm39) missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86,461,124 (GRCm39) missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86,460,857 (GRCm39) missense probably benign
IGL01805:Vmn2r77 APN 7 86,460,395 (GRCm39) missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86,452,224 (GRCm39) missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86,450,678 (GRCm39) missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86,450,763 (GRCm39) missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86,452,836 (GRCm39) nonsense probably null
IGL02185:Vmn2r77 APN 7 86,444,360 (GRCm39) missense unknown
IGL02200:Vmn2r77 APN 7 86,451,187 (GRCm39) missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86,451,224 (GRCm39) missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86,452,848 (GRCm39) nonsense probably null
IGL02557:Vmn2r77 APN 7 86,444,342 (GRCm39) unclassified probably benign
IGL02659:Vmn2r77 APN 7 86,449,979 (GRCm39) missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86,460,555 (GRCm39) missense probably benign
IGL03180:Vmn2r77 APN 7 86,450,843 (GRCm39) missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86,461,131 (GRCm39) missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86,460,494 (GRCm39) missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86,451,146 (GRCm39) missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86,460,858 (GRCm39) missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86,460,383 (GRCm39) missense probably benign
R0689:Vmn2r77 UTSW 7 86,460,872 (GRCm39) missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86,451,224 (GRCm39) missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86,450,954 (GRCm39) missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86,450,242 (GRCm39) critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86,451,394 (GRCm39) missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86,450,830 (GRCm39) missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86,460,356 (GRCm39) missense probably damaging 1.00
R1654:Vmn2r77 UTSW 7 86,461,123 (GRCm39) missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86,444,543 (GRCm39) missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86,450,821 (GRCm39) missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86,461,001 (GRCm39) missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86,449,964 (GRCm39) missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86,450,921 (GRCm39) missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86,450,702 (GRCm39) missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86,461,152 (GRCm39) missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86,460,897 (GRCm39) missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86,452,893 (GRCm39) missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86,450,191 (GRCm39) missense probably benign
R3694:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86,450,044 (GRCm39) missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86,444,368 (GRCm39) nonsense probably null
R3870:Vmn2r77 UTSW 7 86,461,050 (GRCm39) missense probably damaging 1.00
R4733:Vmn2r77 UTSW 7 86,450,195 (GRCm39) missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86,451,015 (GRCm39) missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86,460,846 (GRCm39) missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86,451,341 (GRCm39) missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86,451,271 (GRCm39) missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86,461,214 (GRCm39) missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86,461,235 (GRCm39) missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86,460,670 (GRCm39) nonsense probably null
R5899:Vmn2r77 UTSW 7 86,460,924 (GRCm39) missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86,450,878 (GRCm39) missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86,460,957 (GRCm39) missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86,451,031 (GRCm39) missense probably benign
R6419:Vmn2r77 UTSW 7 86,460,767 (GRCm39) missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86,450,065 (GRCm39) missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86,451,286 (GRCm39) missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86,452,202 (GRCm39) missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86,451,023 (GRCm39) missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86,451,035 (GRCm39) missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86,460,518 (GRCm39) nonsense probably null
R7298:Vmn2r77 UTSW 7 86,449,979 (GRCm39) missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86,460,492 (GRCm39) nonsense probably null
R8182:Vmn2r77 UTSW 7 86,460,801 (GRCm39) missense probably damaging 1.00
R8327:Vmn2r77 UTSW 7 86,450,680 (GRCm39) missense probably benign 0.08
R8387:Vmn2r77 UTSW 7 86,450,947 (GRCm39) missense probably benign 0.00
R8825:Vmn2r77 UTSW 7 86,452,855 (GRCm39) missense probably benign
R8898:Vmn2r77 UTSW 7 86,444,430 (GRCm39) missense probably damaging 1.00
R8973:Vmn2r77 UTSW 7 86,452,150 (GRCm39) missense possibly damaging 0.93
R9258:Vmn2r77 UTSW 7 86,452,302 (GRCm39) missense possibly damaging 0.88
R9338:Vmn2r77 UTSW 7 86,460,994 (GRCm39) missense probably damaging 1.00
R9358:Vmn2r77 UTSW 7 86,452,236 (GRCm39) missense probably benign 0.00
R9377:Vmn2r77 UTSW 7 86,444,442 (GRCm39) missense probably benign 0.05
R9404:Vmn2r77 UTSW 7 86,451,247 (GRCm39) missense probably benign
R9673:Vmn2r77 UTSW 7 86,450,171 (GRCm39) missense possibly damaging 0.75
R9679:Vmn2r77 UTSW 7 86,460,741 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACCCGTATCCTCCATGATTGG -3'
(R):5'- CTGTCATAAAGATGTTGTGTTTGCC -3'

Sequencing Primer
(F):5'- GCTCTCTTTTCAGAGTTACACTTAAG -3'
(R):5'- GATGTTGTGTTTGCCAAAGAAAG -3'
Posted On 2015-11-11