Mutagenetix > Incidental Mutations

Incidental Mutation 'R0332:Plppr5'

35910

Institutional Source

Beutler Lab

Gene Symbol

Plppr5

Ensembl Gene

ENSMUSG00000033342

Gene Name

phospholipid phosphatase related 5

Synonyms

4833424O15Rik, Lppr5

MMRRC Submission

038541-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R0332 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117574836-117689507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117671932 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 277 (R277S)

Ref Sequence

ENSEMBL: ENSMUSP00000102081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039564] [ENSMUST00000106473]

Predicted Effect

probably benign
Transcript: ENSMUST00000039564
AA Change: R277S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000045121
Gene: ENSMUSG00000033342
AA Change: R277S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
acidPPc	123	267	8.27e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106473
AA Change: R277S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000102081
Gene: ENSMUSG00000033342
AA Change: R277S

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
acidPPc	123	267	8.27e-20	SMART

Meta Mutation Damage Score

0.0787

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.6%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	T	17: 23,714,604		probably benign	Het
Aggf1	T	C	13: 95,369,446	E211G	probably damaging	Het
Aox3	A	G	1: 58,142,751	N299S	probably benign	Het
Arhgef7	T	A	8: 11,824,701	Y777*	probably null	Het
Atad1	A	G	19: 32,702,534		probably benign	Het
Bop1	A	G	15: 76,455,987	Y130H	probably damaging	Het
Ccar2	G	T	14: 70,141,935		probably benign	Het
Ccdc110	G	T	8: 45,942,964	E631*	probably null	Het
Cfap54	C	T	10: 93,035,457	D634N	probably damaging	Het
Cldn8	C	T	16: 88,562,358		silent	Het
Cstf3	G	T	2: 104,646,467		probably null	Het
Dgkq	T	C	5: 108,655,099		probably benign	Het
Dsp	T	A	13: 38,182,228	L546*	probably null	Het
Eif3g	A	T	9: 20,897,984		probably benign	Het
Fam228a	T	A	12: 4,735,018	I38F	probably damaging	Het
Fto	A	T	8: 91,401,890		probably benign	Het
Gcnt4	G	T	13: 96,946,510	V105L	probably benign	Het
Gm10644	A	G	8: 83,933,581	L45S	possibly damaging	Het
Gm7275	A	T	16: 48,073,769		noncoding transcript	Het
Gm7579	T	C	7: 142,212,375	S173P	unknown	Het
Gpatch8	T	C	11: 102,481,842	N290S	unknown	Het
Hspb8	T	A	5: 116,409,473	D150V	probably damaging	Het
Ifitm1	T	C	7: 140,968,453		probably benign	Het
Ifnl2	T	C	7: 28,509,331	T99A	possibly damaging	Het
Ints4	T	C	7: 97,517,718	L577P	probably damaging	Het
Jph4	T	C	14: 55,114,010	E183G	possibly damaging	Het
Loxhd1	T	A	18: 77,383,830		probably null	Het
Mug1	G	A	6: 121,849,897		probably null	Het
Nlrp2	C	A	7: 5,317,630	C836F	probably damaging	Het
Nup210l	G	T	3: 90,132,309		probably benign	Het
Olfr18	A	G	9: 20,314,056	L288S	probably benign	Het
Olfr555	A	T	7: 102,659,465	I215F	probably damaging	Het
Optn	C	T	2: 5,024,115	G526R	probably damaging	Het
Phykpl	A	G	11: 51,586,675	E98G	probably benign	Het
Pikfyve	A	G	1: 65,264,399	N1648D	probably benign	Het
Ppp1r36	T	A	12: 76,427,903	F86L	probably benign	Het
Pqlc2	C	T	4: 139,300,299	S244N	possibly damaging	Het
Ptgis	A	T	2: 167,214,833	L278Q	probably damaging	Het
Rasa2	A	T	9: 96,606,176	F90Y	probably damaging	Het
Setd3	T	C	12: 108,107,579	K480E	probably benign	Het
Snx2	T	C	18: 53,212,911	F389L	probably benign	Het
Sulf2	G	A	2: 166,089,199	T296M	probably benign	Het
Supt16	A	T	14: 52,181,157	H214Q	probably damaging	Het
Tbx4	A	T	11: 85,898,530	M12L	probably benign	Het
Tlk1	A	T	2: 70,745,565		probably null	Het
Tmprss7	C	T	16: 45,680,638	V267M	probably benign	Het
Tmub2	G	A	11: 102,288,348	R291H	probably damaging	Het
Trpm2	A	T	10: 77,947,988	V217E	probably damaging	Het
Try10	T	A	6: 41,354,220	V10E	probably benign	Het
Ttn	A	G	2: 76,765,882	V20229A	probably benign	Het
Ttn	A	C	2: 76,778,194		probably null	Het
Uhrf1bp1	T	C	17: 27,893,294		probably null	Het
Usf2	T	A	7: 30,955,179	M199L	possibly damaging	Het
Usp37	A	T	1: 74,495,710	S26T	possibly damaging	Het
Vrk1	G	C	12: 106,058,625	Q253H	probably benign	Het
Wdr72	A	T	9: 74,157,252		probably null	Het
Xrra1	T	C	7: 99,876,242	F123L	probably damaging	Het
Zfhx3	T	C	8: 108,946,623	I1435T	probably damaging	Het
Zfp712	T	A	13: 67,040,813	H550L	probably damaging	Het

Other mutations in Plppr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Plppr5	APN	3	117671943	missense	possibly damaging	0.46
IGL01081:Plppr5	APN	3	117686649	utr 3 prime	probably benign
IGL01315:Plppr5	APN	3	117662526	missense	probably damaging	1.00
IGL02802:Plppr5	UTSW	3	117662579	missense	probably damaging	1.00
R0044:Plppr5	UTSW	3	117671889	splice site	probably null
R0044:Plppr5	UTSW	3	117671889	splice site	probably null
R0757:Plppr5	UTSW	3	117575891	missense	probably benign	0.16
R1101:Plppr5	UTSW	3	117662523	missense	probably damaging	0.99
R1354:Plppr5	UTSW	3	117575847	missense	possibly damaging	0.94
R1498:Plppr5	UTSW	3	117662612	missense	probably damaging	0.97
R1967:Plppr5	UTSW	3	117625906	critical splice donor site	probably null
R2090:Plppr5	UTSW	3	117575871	missense	possibly damaging	0.63
R4661:Plppr5	UTSW	3	117620969	missense	probably damaging	1.00
R5143:Plppr5	UTSW	3	117625903	missense	probably benign
R5441:Plppr5	UTSW	3	117662471	missense	possibly damaging	0.94
R5722:Plppr5	UTSW	3	117621065	missense	probably benign	0.00
R6560:Plppr5	UTSW	3	117671990	missense	probably benign	0.09
R7221:Plppr5	UTSW	3	117620969	missense	probably damaging	1.00
R8556:Plppr5	UTSW	3	117672030	missense	probably benign
Z1177:Plppr5	UTSW	3	117625779	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGTGCCAACTGTCAAGGATTAGAGTG -3'
(R):5'- TTCTATGCACAGTTACCAAGCTTCCAG -3'

Sequencing Primer
(F):5'- CATGGTAAGTCTGCGTGTAAAG -3'
(R):5'- GTTACCAAGCTTCCAGCATGG -3'

Posted On

2013-05-09