Mutagenetix > Incidental Mutation

Incidental Mutation 'R4732:Lrrk2'

359104

Institutional Source

Beutler Lab

Gene Symbol

Lrrk2

Ensembl Gene

ENSMUSG00000036273

Gene Name

leucine-rich repeat kinase 2

Synonyms

9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik

MMRRC Submission

042022-MU

Accession Numbers

Genbank: NM_025730; MGI: 1913975

Essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

R4732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91673175-91816120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 91688849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 200 (E200A)

Ref Sequence

ENSEMBL: ENSMUSP00000052584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060642]

AlphaFold

Q5S006

Predicted Effect

probably damaging
Transcript: ENSMUST00000060642
AA Change: E200A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: E200A

Domain	Start	End	E-Value	Type
low complexity region	138	156	N/A	INTRINSIC
low complexity region	332	347	N/A	INTRINSIC
ANK	708	737	3.95e1	SMART
ANK	770	800	4.58e2	SMART
low complexity region	890	901	N/A	INTRINSIC
low complexity region	953	966	N/A	INTRINSIC
low complexity region	971	979	N/A	INTRINSIC
LRR	1010	1033	9.96e-1	SMART
LRR	1034	1057	8.01e0	SMART
LRR	1082	1105	2.45e0	SMART
LRR	1128	1151	9.3e-1	SMART
LRR	1195	1219	3.24e0	SMART
LRR	1244	1266	3.87e1	SMART
LRR	1267	1291	4.98e1	SMART
Pfam:Roc	1336	1456	4.9e-32	PFAM
Pfam:Ras	1336	1489	3.3e-17	PFAM
Pfam:COR	1524	1740	4e-28	PFAM
Pfam:Pkinase	1881	2132	4.7e-40	PFAM
Pfam:Pkinase_Tyr	1882	2132	6.8e-39	PFAM
WD40	2231	2276	3.09e-1	SMART
WD40	2401	2438	1.37e2	SMART

Meta Mutation Damage Score

0.2076

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock

Total: 191 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	T	A	9: 8,222,173		noncoding transcript	Het
3110035E14Rik	T	C	1: 9,606,976	S24P	probably benign	Het
4933409G03Rik	A	G	2: 68,614,721		probably benign	Het
Acan	T	C	7: 79,098,609	S1043P	probably damaging	Het
Ackr2	A	G	9: 121,909,183	Y208C	probably damaging	Het
Actg1	C	T	11: 120,347,479		probably benign	Het
Adam1a	T	A	5: 121,519,434	T599S	probably benign	Het
Adamts12	A	T	15: 11,270,662	S668C	probably damaging	Het
Adcy8	A	G	15: 64,754,862	V709A	possibly damaging	Het
Adgrf2	A	C	17: 42,710,754	I393S	probably damaging	Het
Ahnak	G	T	19: 9,007,301	G1983V	probably damaging	Het
AI413582	A	G	17: 27,565,270		probably benign	Het
Aim2	T	A	1: 173,463,876	D282E	possibly damaging	Het
Ak8	A	G	2: 28,760,071	Y370C	probably damaging	Het
Akap9	A	G	5: 4,013,901	D1750G	probably damaging	Het
Als2cl	T	A	9: 110,889,136	V315E	probably damaging	Het
Ankrd28	A	C	14: 31,755,741	C115G	probably benign	Het
Ap3b2	C	T	7: 81,471,932	A519T	probably damaging	Het
Apool	C	T	X: 112,372,200	T166I	probably damaging	Het
Arhgef2	A	T	3: 88,631,940	K65*	probably null	Het
Arhgef38	G	T	3: 133,132,269	Y633*	probably null	Het
Asah2	T	C	19: 31,995,358	N659S	probably benign	Het
Atf7ip2	A	G	16: 10,241,886	D430G	possibly damaging	Het
Atp8a1	G	A	5: 67,813,120	S92L	probably benign	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
BC024978	T	A	7: 27,201,043	M149K	probably damaging	Het
C130073F10Rik	C	A	4: 101,890,710	S89I	probably benign	Het
Cacna1g	T	C	11: 94,443,215	T867A	probably damaging	Het
Ccdc88a	T	G	11: 29,485,906	N1276K	probably benign	Het
Cdc42bpg	T	A	19: 6,311,191	V282E	probably damaging	Het
Cdipt	T	A	7: 126,978,358	L92H	probably damaging	Het
Celsr2	T	A	3: 108,398,952	D2012V	probably damaging	Het
Cenpt	A	G	8: 105,847,136	V254A	probably benign	Het
Cep104	T	A	4: 153,988,426	D380E	probably damaging	Het
Cers5	C	T	15: 99,741,637	R123Q	probably benign	Het
Ces2h	A	G	8: 105,014,604	E76G	probably damaging	Het
Cfap77	T	A	2: 28,984,388	E143D	probably benign	Het
Chmp7	C	A	14: 69,732,296	R65L	probably damaging	Het
Cldnd2	T	A	7: 43,442,189	C65S	possibly damaging	Het
Clec2g	C	A	6: 128,981,879	Y142*	probably null	Het
Coch	A	T	12: 51,605,019	E549V	probably benign	Het
Cog7	T	C	7: 121,964,244	D215G	probably benign	Het
Col4a2	A	G	8: 11,446,197	H1606R	probably benign	Het
Col4a2	T	C	8: 11,414,779	V348A	probably benign	Het
Cpd	T	C	11: 76,811,794	N583D	probably damaging	Het
Cyp2d11	T	A	15: 82,389,227	Y481F	probably benign	Het
D130043K22Rik	T	C	13: 24,899,665	S1038P	probably damaging	Het
Deptor	C	A	15: 55,181,010	H191N	probably benign	Het
Dgkz	A	T	2: 91,938,339	I699N	probably damaging	Het
Dnah12	C	T	14: 26,781,784	T1653I	probably damaging	Het
Dnah7c	T	A	1: 46,770,173	N3550K	probably damaging	Het
Dnah8	A	G	17: 30,775,061	K3384R	probably null	Het
Dnajc11	A	G	4: 151,970,967		probably benign	Het
Dnajc13	CT	C	9: 104,186,805		probably benign	Het
Dnhd1	C	A	7: 105,673,849	N521K	probably benign	Het
Drg2	T	C	11: 60,461,396		probably null	Het
Dync1h1	C	T	12: 110,649,507	Q3030*	probably null	Het
Efhb	G	A	17: 53,426,244	T533I	probably damaging	Het
Eif2d	T	C	1: 131,164,727	V374A	probably damaging	Het
Etfb	T	C	7: 43,444,200	V17A	probably damaging	Het
F5	C	T	1: 164,181,657	T332M	probably damaging	Het
Fcho1	T	C	8: 71,716,795	T156A	probably benign	Het
Fn1	A	T	1: 71,602,512		probably null	Het
Fnip2	A	T	3: 79,481,652	S561T	probably damaging	Het
Frs2	T	A	10: 117,074,093	T455S	probably benign	Het
Fry	G	A	5: 150,386,007	E639K		Het
Fto	T	A	8: 91,409,714	D205E	probably damaging	Het
Galntl6	G	A	8: 58,427,813	P147L	probably damaging	Het
Gigyf1	T	A	5: 137,524,770	D844E	probably benign	Het
Gle1	T	C	2: 29,940,232	S267P	probably damaging	Het
Glg1	G	A	8: 111,187,755	R466W	probably damaging	Het
Gm10277	T	C	11: 77,786,097		probably benign	Het
Gm20388	A	G	8: 122,270,274		probably benign	Het
Gm5724	A	T	6: 141,723,179	M509K	probably benign	Het
Gm6871	T	C	7: 41,546,749	I39V	probably benign	Het
Gm9970	A	G	5: 31,241,066		probably benign	Het
Gpr35	T	G	1: 92,983,385	I57S	probably damaging	Het
Gprin1	C	T	13: 54,739,957	G168E	possibly damaging	Het
Gtdc1	A	G	2: 44,789,055		probably benign	Het
Gtf3c2	G	T	5: 31,160,057	P586T	probably damaging	Het
Gucy1a2	A	T	9: 3,759,424	H410L	probably benign	Het
Gucy2c	A	G	6: 136,767,152	S150P	probably damaging	Het
Ifi214	T	C	1: 173,526,591	Q171R	probably benign	Het
Ifit1bl1	T	C	19: 34,594,321	I245M	probably benign	Het
Igkv4-50	T	C	6: 69,701,000	K40R	probably benign	Het
Igkv8-18	T	A	6: 70,356,296	I74N	probably damaging	Het
Il2ra	T	A	2: 11,676,920	M112K	probably benign	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
Kbtbd7	T	C	14: 79,428,800	*691Q	probably null	Het
Kcnn2	T	A	18: 45,560,349	S331T	possibly damaging	Het
Khnyn	T	A	14: 55,886,489		probably null	Het
Kif26a	G	A	12: 112,175,573	A754T	probably benign	Het
Klra3	T	A	6: 130,327,132	Y199F	possibly damaging	Het
Lhx2	A	G	2: 38,359,991	K274R	probably damaging	Het
Lrp2	T	C	2: 69,533,555	I313V	probably benign	Het
Lrrfip1	A	T	1: 91,115,647	E591D	probably benign	Het
Mast4	A	T	13: 102,772,572	M465K	probably damaging	Het
Moxd2	T	G	6: 40,878,859	I599L	probably benign	Het
Mug2	T	C	6: 122,071,872	S866P	probably damaging	Het
Ncam2	A	G	16: 81,434,884	T79A	possibly damaging	Het
Ncoa6	C	A	2: 155,421,301	Q404H	probably damaging	Het
Neb	A	G	2: 52,279,079	Y1815H	probably damaging	Het
Nell1	A	G	7: 50,856,217	D724G	probably damaging	Het
Nkx3-2	A	G	5: 41,762,144	V167A	probably benign	Het
Nsun3	C	A	16: 62,735,119	C348F	possibly damaging	Het
Obox6	A	T	7: 15,834,772	S60T	possibly damaging	Het
Olfr1	T	C	11: 73,395,695	D109G	probably benign	Het
Olfr1378	G	A	11: 50,969,266	V83M	possibly damaging	Het
Olfr138	T	A	17: 38,275,547	Y259N	probably damaging	Het
Olfr466	T	C	13: 65,152,653	V143A	possibly damaging	Het
Olfr744	T	A	14: 50,618,569	C116S	probably benign	Het
Olfr94	T	C	17: 37,197,024	T315A	probably damaging	Het
Olfr980	A	T	9: 40,006,268	I227N	probably damaging	Het
Oog2	T	A	4: 144,193,941		probably benign	Het
Pabpc1	A	T	15: 36,599,284	V389E	probably benign	Het
Pank4	A	T	4: 154,971,390	M291L	probably benign	Het
Pcf11	T	C	7: 92,658,833	D709G	probably benign	Het
Pcgf1	T	A	6: 83,079,957		probably benign	Het
Pcnx	A	G	12: 81,995,751	I2256V	probably benign	Het
Pex6	A	G	17: 46,722,288	D579G	probably benign	Het
Pex6	A	G	17: 46,724,707		probably null	Het
Piezo2	C	T	18: 63,030,401	A2149T	probably damaging	Het
Pik3c2g	A	G	6: 139,935,985	E781G	probably benign	Het
Pik3r4	G	A	9: 105,678,176	V1111I	possibly damaging	Het
Pkd1l2	T	A	8: 116,995,842		probably null	Het
Plekhg1	T	A	10: 3,957,506	S808T	probably benign	Het
Pnkp	T	A	7: 44,860,454		probably benign	Het
Polr3c	A	T	3: 96,723,661	F148I	probably damaging	Het
Ppard	A	T	17: 28,286,443	T35S	probably benign	Het
Ptov1	T	C	7: 44,867,109	D134G	probably benign	Het
Ptprz1	T	A	6: 23,002,610	S1566R	probably benign	Het
Pum1	T	C	4: 130,718,193	S158P	probably benign	Het
Qk	T	C	17: 10,216,288	H269R	probably damaging	Het
Qrsl1	T	C	10: 43,876,663	Y388C	probably damaging	Het
Rapgef1	T	G	2: 29,689,160	I182S	probably damaging	Het
Ret	T	C	6: 118,163,193	S1013G	possibly damaging	Het
Rimbp3	A	G	16: 17,210,601	R630G	possibly damaging	Het
Rnmt	A	T	18: 68,317,960		probably benign	Het
Ryr2	A	T	13: 11,577,909	M4653K	possibly damaging	Het
Sacm1l	G	A	9: 123,590,830	V553I	probably benign	Het
Sec31b	A	T	19: 44,532,677	S110T	probably damaging	Het
Serpina3k	G	A	12: 104,340,860	G117D	probably damaging	Het
Sesn2	T	C	4: 132,494,591	Y410C	probably damaging	Het
Slc24a1	G	A	9: 64,949,554	R24C	probably benign	Het
Slc35g2	A	C	9: 100,552,502	V372G	probably benign	Het
Slc7a7	T	C	14: 54,408,733	Y91C	probably damaging	Het
Slc7a9	T	A	7: 35,453,563	Y135*	probably null	Het
Slco4a1	A	G	2: 180,473,615	N662D	probably damaging	Het
Slfn4	T	A	11: 83,189,282		probably benign	Het
Slmap	T	C	14: 26,468,535	N156S	probably damaging	Het
Snx18	A	G	13: 113,617,774	S208P	probably benign	Het
Sorbs1	T	A	19: 40,314,689	R485S	probably benign	Het
Spib	A	G	7: 44,528,885	S154P	probably damaging	Het
Spty2d1	T	C	7: 46,996,110	D595G	probably damaging	Het
St7	T	A	6: 17,906,516		probably null	Het
Susd1	T	C	4: 59,428,029	T52A	possibly damaging	Het
Svs2	T	A	2: 164,237,123	D288V	possibly damaging	Het
Syt7	T	A	19: 10,442,924	I355N	probably damaging	Het
Tarm1	G	A	7: 3,496,900	Q145*	probably null	Het
Teddm2	T	A	1: 153,850,741	E76V	probably damaging	Het
Thsd7b	T	C	1: 129,613,186	S343P	probably damaging	Het
Tigd2	T	A	6: 59,211,415	H422Q	probably benign	Het
Tle1	T	C	4: 72,125,019	N538D	possibly damaging	Het
Tmc2	A	G	2: 130,261,397		probably null	Het
Tmtc1	A	C	6: 148,284,980		probably null	Het
Tns3	C	T	11: 8,450,986	R1104H	probably benign	Het
Trim6	T	C	7: 104,232,648	Y369H	probably damaging	Het
Triobp	G	A	15: 78,967,113	R489K	probably damaging	Het
Trpv4	T	C	5: 114,622,753	D732G	possibly damaging	Het
Trrap	G	A	5: 144,816,570	V1883I	probably damaging	Het
Tsc2	C	A	17: 24,603,275	V1141F	possibly damaging	Het
Ttn	A	T	2: 76,943,011	M2395K	unknown	Het
Ttn	A	G	2: 76,899,827		probably benign	Het
Tyrp1	A	T	4: 80,844,935	D353V	possibly damaging	Het
Ubd	A	C	17: 37,195,702	T160P	probably benign	Het
Ugt2b36	G	T	5: 87,081,538	Y156*	probably null	Het
Ulk4	G	A	9: 121,263,638	R178*	probably null	Het
Unc13d	A	G	11: 116,073,582	V312A	possibly damaging	Het
Urb2	G	T	8: 124,028,897	A448S	probably damaging	Het
Urod	G	A	4: 116,991,673	A92V	possibly damaging	Het
Vmn1r33	T	A	6: 66,611,819	R250S	probably benign	Het
Vmn1r87	A	T	7: 13,132,327	M11K	possibly damaging	Het
Vmn2r77	C	T	7: 86,800,987	T147I	probably benign	Het
Vstm4	A	G	14: 32,917,902	K96E	possibly damaging	Het
Washc4	A	T	10: 83,574,479	M644L	probably benign	Het
Wwp1	T	C	4: 19,661,990	D172G	probably benign	Het
Zbtb38	A	T	9: 96,687,684	V449E	probably damaging	Het
Zfhx4	T	C	3: 5,214,807		probably benign	Het
Zfp229	C	T	17: 21,745,286	H166Y	possibly damaging	Het
Zfp512b	A	G	2: 181,588,739	S453P	probably benign	Het
Zp2	C	A	7: 120,138,120	V282L	probably damaging	Het

Other mutations in Lrrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Lrrk2	APN	15	91747799	missense	possibly damaging	0.90
IGL00542:Lrrk2	APN	15	91699943	missense	probably benign
IGL00770:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00774:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00791:Lrrk2	APN	15	91779841	missense	probably damaging	1.00
IGL00827:Lrrk2	APN	15	91755790	missense	probably damaging	1.00
IGL00843:Lrrk2	APN	15	91757058	missense	possibly damaging	0.58
IGL01109:Lrrk2	APN	15	91738832	missense	probably damaging	1.00
IGL01293:Lrrk2	APN	15	91726137	missense	probably benign	0.21
IGL01296:Lrrk2	APN	15	91683142	missense	probably benign
IGL01301:Lrrk2	APN	15	91767339	missense	probably damaging	1.00
IGL01360:Lrrk2	APN	15	91700569	splice site	probably null
IGL01465:Lrrk2	APN	15	91728925	missense	probably benign	0.21
IGL01529:Lrrk2	APN	15	91812313	missense	possibly damaging	0.92
IGL01557:Lrrk2	APN	15	91699989	missense	probably damaging	1.00
IGL01560:Lrrk2	APN	15	91774988	missense	probably benign	0.33
IGL01991:Lrrk2	APN	15	91779946	missense	probably damaging	0.99
IGL02003:Lrrk2	APN	15	91731491	missense	probably damaging	0.99
IGL02325:Lrrk2	APN	15	91726308	critical splice donor site	probably null
IGL02711:Lrrk2	APN	15	91685822	missense	possibly damaging	0.71
IGL02869:Lrrk2	APN	15	91750277	missense	probably damaging	1.00
IGL03104:Lrrk2	APN	15	91747755	missense	possibly damaging	0.68
IGL03179:Lrrk2	APN	15	91700578	missense	probably damaging	1.00
IGL03395:Lrrk2	APN	15	91797414	splice site	probably null
horned	UTSW	15	91772858	missense	probably damaging	1.00
R1312_Lrrk2_980	UTSW	15	91699895	missense	probably damaging	1.00
R4710_lrrk2_232	UTSW	15	91699927	missense	possibly damaging	0.88
R5245_Lrrk2_127	UTSW	15	91796089	missense	probably damaging	1.00
spree	UTSW	15	91702247	missense	probably benign	0.00
Spur	UTSW	15	91774995	nonsense	probably null
3-1:Lrrk2	UTSW	15	91801934	missense	probably benign	0.01
ANU18:Lrrk2	UTSW	15	91767339	missense	probably damaging	1.00
H8562:Lrrk2	UTSW	15	91673358	missense	probably benign
H8786:Lrrk2	UTSW	15	91673358	missense	probably benign
IGL02835:Lrrk2	UTSW	15	91814660	critical splice acceptor site	probably null
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0078:Lrrk2	UTSW	15	91734009	missense	probably benign	0.01
R0100:Lrrk2	UTSW	15	91745796	missense	probably damaging	1.00
R0282:Lrrk2	UTSW	15	91778414	splice site	probably benign
R0448:Lrrk2	UTSW	15	91709305	missense	probably damaging	0.99
R0449:Lrrk2	UTSW	15	91750275	missense	probably damaging	1.00
R0610:Lrrk2	UTSW	15	91815416	missense	probably benign
R0617:Lrrk2	UTSW	15	91752278	missense	probably benign	0.00
R0632:Lrrk2	UTSW	15	91796028	missense	probably damaging	0.98
R0639:Lrrk2	UTSW	15	91772996	missense	probably benign	0.03
R0661:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R0666:Lrrk2	UTSW	15	91757070	critical splice donor site	probably null
R0764:Lrrk2	UTSW	15	91775046	splice site	probably null
R0766:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R0845:Lrrk2	UTSW	15	91755962	missense	probably benign	0.22
R0940:Lrrk2	UTSW	15	91729081	missense	possibly damaging	0.83
R0970:Lrrk2	UTSW	15	91729169	missense	probably benign	0.22
R1080:Lrrk2	UTSW	15	91673689	missense	probably benign	0.01
R1114:Lrrk2	UTSW	15	91700468	nonsense	probably null
R1223:Lrrk2	UTSW	15	91673635	missense	probably benign	0.00
R1289:Lrrk2	UTSW	15	91812360	missense	probably benign	0.00
R1296:Lrrk2	UTSW	15	91728920	missense	probably damaging	1.00
R1312:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R1637:Lrrk2	UTSW	15	91734058	missense	probably benign
R1773:Lrrk2	UTSW	15	91779981	missense	possibly damaging	0.96
R1809:Lrrk2	UTSW	15	91699892	missense	possibly damaging	0.86
R1839:Lrrk2	UTSW	15	91683134	missense	probably benign	0.00
R1946:Lrrk2	UTSW	15	91736661	splice site	probably null
R2160:Lrrk2	UTSW	15	91796060	missense	probably damaging	1.00
R2232:Lrrk2	UTSW	15	91764716	missense	probably benign	0.05
R2419:Lrrk2	UTSW	15	91797526	splice site	probably benign
R2516:Lrrk2	UTSW	15	91755927	missense	probably benign
R3110:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3112:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3801:Lrrk2	UTSW	15	91737111	missense	probably benign
R3842:Lrrk2	UTSW	15	91755916	missense	probably benign	0.01
R3903:Lrrk2	UTSW	15	91747700	missense	probably damaging	1.00
R3903:Lrrk2	UTSW	15	91747701	missense	probably damaging	1.00
R3930:Lrrk2	UTSW	15	91767461	critical splice donor site	probably null
R3937:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91712780	missense	possibly damaging	0.69
R3938:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3982:Lrrk2	UTSW	15	91709284	missense	probably benign	0.22
R4125:Lrrk2	UTSW	15	91815483	missense	probably benign	0.01
R4130:Lrrk2	UTSW	15	91755794	missense	probably benign	0.19
R4296:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R4465:Lrrk2	UTSW	15	91747820	missense	probably damaging	0.96
R4478:Lrrk2	UTSW	15	91723188	missense	probably damaging	1.00
R4517:Lrrk2	UTSW	15	91705120	missense	probably benign
R4539:Lrrk2	UTSW	15	91729142	missense	possibly damaging	0.86
R4654:Lrrk2	UTSW	15	91765681	missense	probably damaging	0.96
R4710:Lrrk2	UTSW	15	91699927	missense	possibly damaging	0.88
R4722:Lrrk2	UTSW	15	91688901	missense	probably damaging	1.00
R4723:Lrrk2	UTSW	15	91764759	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91688849	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4787:Lrrk2	UTSW	15	91712828	missense	probably benign
R4945:Lrrk2	UTSW	15	91804920	missense	probably benign	0.02
R4948:Lrrk2	UTSW	15	91803389	missense	probably benign	0.20
R5000:Lrrk2	UTSW	15	91749878	missense	probably damaging	1.00
R5031:Lrrk2	UTSW	15	91700619	missense	possibly damaging	0.50
R5067:Lrrk2	UTSW	15	91765790	missense	probably benign	0.01
R5245:Lrrk2	UTSW	15	91796089	missense	probably damaging	1.00
R5341:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R5460:Lrrk2	UTSW	15	91814644	splice site	probably null
R5551:Lrrk2	UTSW	15	91812350	missense	probably benign
R5574:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R5577:Lrrk2	UTSW	15	91765745	missense	probably damaging	1.00
R5685:Lrrk2	UTSW	15	91803301	nonsense	probably null
R5712:Lrrk2	UTSW	15	91702222	nonsense	probably null
R5728:Lrrk2	UTSW	15	91774974	missense	probably benign	0.36
R5782:Lrrk2	UTSW	15	91702183	missense	probably damaging	1.00
R5788:Lrrk2	UTSW	15	91764648	missense	possibly damaging	0.55
R5821:Lrrk2	UTSW	15	91709390	critical splice donor site	probably null
R5852:Lrrk2	UTSW	15	91755949	missense	probably damaging	1.00
R5934:Lrrk2	UTSW	15	91734046	missense	probably benign	0.00
R5935:Lrrk2	UTSW	15	91745831	missense	probably benign	0.14
R5979:Lrrk2	UTSW	15	91772945	missense	possibly damaging	0.47
R6101:Lrrk2	UTSW	15	91723135	missense	probably benign	0.10
R6114:Lrrk2	UTSW	15	91747826	missense	probably benign	0.33
R6259:Lrrk2	UTSW	15	91702247	missense	probably benign	0.00
R6376:Lrrk2	UTSW	15	91742266	missense	possibly damaging	0.89
R6417:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6420:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6737:Lrrk2	UTSW	15	91723218	missense	possibly damaging	0.50
R7056:Lrrk2	UTSW	15	91774995	nonsense	probably null
R7072:Lrrk2	UTSW	15	91801920	missense	probably benign	0.03
R7109:Lrrk2	UTSW	15	91764782	missense	probably damaging	1.00
R7128:Lrrk2	UTSW	15	91801885	missense	probably benign
R7144:Lrrk2	UTSW	15	91734055	missense	possibly damaging	0.54
R7187:Lrrk2	UTSW	15	91757001	missense	possibly damaging	0.92
R7270:Lrrk2	UTSW	15	91700441	missense	probably benign	0.01
R7356:Lrrk2	UTSW	15	91738744	missense	probably benign	0.07
R7360:Lrrk2	UTSW	15	91731655	critical splice donor site	probably null
R7373:Lrrk2	UTSW	15	91700004	critical splice donor site	probably null
R7465:Lrrk2	UTSW	15	91767340	missense	probably damaging	1.00
R7477:Lrrk2	UTSW	15	91812325	missense	probably damaging	0.98
R7614:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R7622:Lrrk2	UTSW	15	91812323	missense	probably damaging	1.00
R7658:Lrrk2	UTSW	15	91700358	missense	possibly damaging	0.91
R7679:Lrrk2	UTSW	15	91726186	missense	possibly damaging	0.58
R7737:Lrrk2	UTSW	15	91815446	missense	probably damaging	0.98
R7739:Lrrk2	UTSW	15	91700613	missense	probably damaging	1.00
R7740:Lrrk2	UTSW	15	91767324	missense	probably damaging	1.00
R7908:Lrrk2	UTSW	15	91726152	missense	probably damaging	1.00
R8299:Lrrk2	UTSW	15	91673240	start gained	probably benign
R8389:Lrrk2	UTSW	15	91699991	missense	probably damaging	1.00
R8462:Lrrk2	UTSW	15	91731477	missense	probably benign
R8698:Lrrk2	UTSW	15	91752197	missense	probably benign	0.38
R8947:Lrrk2	UTSW	15	91702270	nonsense	probably null
R9084:Lrrk2	UTSW	15	91750266	missense
R9086:Lrrk2	UTSW	15	91755848	missense	probably benign	0.01
R9096:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9097:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9267:Lrrk2	UTSW	15	91700426	missense	probably damaging	0.99
R9285:Lrrk2	UTSW	15	91778483	missense	probably damaging	1.00
R9341:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9343:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9371:Lrrk2	UTSW	15	91723204	missense	probably damaging	1.00
R9424:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9489:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9502:Lrrk2	UTSW	15	91723162	missense	probably damaging	0.98
R9563:Lrrk2	UTSW	15	91749840	missense	possibly damaging	0.90
R9576:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9605:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9635:Lrrk2	UTSW	15	91812324	missense	probably benign	0.21
R9641:Lrrk2	UTSW	15	91787048	missense	possibly damaging	0.94
R9660:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9673:Lrrk2	UTSW	15	91765681	missense	probably damaging	1.00
R9708:Lrrk2	UTSW	15	91750279	nonsense	probably null
R9728:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9757:Lrrk2	UTSW	15	91811026	missense	probably benign	0.03
RF001:Lrrk2	UTSW	15	91736633	missense	probably benign	0.11
X0028:Lrrk2	UTSW	15	91738851	missense	probably benign	0.00
Z1088:Lrrk2	UTSW	15	91726240	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TCTAATGTGTCAAATTCCGACGTC -3'
(R):5'- ATTTAGCAGCCACCGAACTC -3'

Sequencing Primer
(F):5'- CCGACGTCATTTTTGCAGAAACG -3'
(R):5'- TACATTTAGAAAAGCGACGCATC -3'

Posted On

2015-11-11