Incidental Mutation 'R4734:Sdad1'
ID 359144
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene Name SDA1 domain containing 1
Synonyms
MMRRC Submission 041961-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R4734 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92431869-92457883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 92452836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 134 (R134Q)
Ref Sequence ENSEMBL: ENSMUSP00000144446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143] [ENSMUST00000202870]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031364
AA Change: R134Q

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: R134Q

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201084
Predicted Effect possibly damaging
Transcript: ENSMUST00000201143
AA Change: R134Q

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: R134Q

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202680
Predicted Effect probably benign
Transcript: ENSMUST00000202870
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,603,961 (GRCm39) M1V probably null Het
Abcb11 T A 2: 69,154,306 (GRCm39) T87S possibly damaging Het
Arap3 A G 18: 38,129,328 (GRCm39) V210A probably benign Het
Avl9 T C 6: 56,713,479 (GRCm39) S246P probably damaging Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Cdhr18 T C 14: 13,845,292 (GRCm38) N540S probably benign Het
Cfap96 A T 8: 46,423,454 (GRCm39) M86K possibly damaging Het
Chsy3 C A 18: 59,312,485 (GRCm39) F319L probably benign Het
Coro2b T C 9: 62,333,860 (GRCm39) T345A probably benign Het
Cpb1 A G 3: 20,317,876 (GRCm39) V216A probably benign Het
Cyp2c65 A G 19: 39,060,778 (GRCm39) I213V probably benign Het
Dcaf15 A G 8: 84,824,357 (GRCm39) C586R probably benign Het
Ddr2 T A 1: 169,825,657 (GRCm39) E314D probably benign Het
Dennd5a C T 7: 109,495,543 (GRCm39) R1196H probably damaging Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dpf2 A G 19: 5,957,027 (GRCm39) probably null Het
Eif2ak4 A T 2: 118,252,568 (GRCm39) H302L probably damaging Het
Eif2d G T 1: 131,092,889 (GRCm39) R399L probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Fhod3 T A 18: 25,161,192 (GRCm39) Y575N probably benign Het
Fscb T C 12: 64,521,244 (GRCm39) E74G possibly damaging Het
Gdpd2 G A X: 99,777,799 (GRCm39) M243I possibly damaging Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gnl2 T C 4: 124,934,811 (GRCm39) F156L probably benign Het
Gpr37 C A 6: 25,689,085 (GRCm39) R4L possibly damaging Het
Hectd4 A T 5: 121,480,040 (GRCm39) H2892L possibly damaging Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Impact T A 18: 13,118,346 (GRCm39) H188Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lnx2 C T 5: 146,965,947 (GRCm39) G391R probably damaging Het
Lrrc19 T C 4: 94,526,586 (GRCm39) I324V probably benign Het
Lrrcc1 G T 3: 14,627,345 (GRCm39) Q458H probably damaging Het
Maml3 A T 3: 51,597,296 (GRCm39) D483E probably damaging Het
Mef2c T A 13: 83,810,748 (GRCm39) *467R probably null Het
Mms19 T A 19: 41,932,997 (GRCm39) S1031C probably damaging Het
Myt1l T C 12: 29,969,925 (GRCm39) I143T possibly damaging Het
Nuggc T C 14: 65,860,679 (GRCm39) Y426H probably damaging Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Oog2 T C 4: 143,923,021 (GRCm39) S429P probably benign Het
Or4d1 T A 11: 87,805,016 (GRCm39) T239S probably damaging Het
Or51f1 A G 7: 102,506,186 (GRCm39) I101T probably damaging Het
Or5p1 A T 7: 107,916,959 (GRCm39) N286I probably damaging Het
Or5p51 T C 7: 107,444,635 (GRCm39) I102V probably benign Het
Pcnt T C 10: 76,273,040 (GRCm39) D93G probably benign Het
Pdia5 A T 16: 35,276,883 (GRCm39) M95K probably benign Het
Pdzrn4 A T 15: 92,668,133 (GRCm39) R762* probably null Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Ppil3 A G 1: 58,470,428 (GRCm39) Y141H probably benign Het
Prb1c T A 6: 132,338,891 (GRCm39) N109I unknown Het
Rassf8 G T 6: 145,761,266 (GRCm39) K197N probably benign Het
Ryr2 T C 13: 11,752,639 (GRCm39) Q1894R probably damaging Het
Ryr3 T A 2: 112,740,847 (GRCm39) N487Y probably damaging Het
Scn5a T C 9: 119,368,604 (GRCm39) Y307C probably damaging Het
Shroom1 C T 11: 53,356,060 (GRCm39) S370F probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc2a9 C A 5: 38,539,442 (GRCm39) G353C probably damaging Het
Snx33 T A 9: 56,833,185 (GRCm39) T295S possibly damaging Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Supt6 T C 11: 78,115,509 (GRCm39) D761G probably benign Het
Tfeb T C 17: 48,096,787 (GRCm39) V18A probably benign Het
Thap12 G T 7: 98,365,161 (GRCm39) C443F probably damaging Het
Thap12 T A 7: 98,365,162 (GRCm39) C443* probably null Het
Tmem67 T C 4: 12,063,158 (GRCm39) D496G probably benign Het
Trappc8 G A 18: 20,974,629 (GRCm39) R900* probably null Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Trmt1l A T 1: 151,318,388 (GRCm39) I80L probably benign Het
Trpm5 C A 7: 142,636,522 (GRCm39) V472L probably benign Het
Tspear C T 10: 77,700,529 (GRCm39) L120F probably damaging Het
Ttc9b G A 7: 27,355,443 (GRCm39) V238M probably benign Het
Usp20 A G 2: 30,909,836 (GRCm39) I819V probably benign Het
Vmn2r102 T A 17: 19,897,795 (GRCm39) V270E probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 106,210,376 (GRCm39) probably null Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92,451,632 (GRCm39) splice site probably null
IGL01355:Sdad1 APN 5 92,450,538 (GRCm39) missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92,445,019 (GRCm39) missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92,439,621 (GRCm39) missense probably benign 0.03
IGL02503:Sdad1 APN 5 92,449,661 (GRCm39) unclassified probably benign
IGL02739:Sdad1 APN 5 92,437,931 (GRCm39) missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92,439,777 (GRCm39) missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92,452,923 (GRCm39) missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92,446,092 (GRCm39) missense probably benign 0.32
R1496:Sdad1 UTSW 5 92,457,682 (GRCm39) missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92,453,155 (GRCm39) nonsense probably null
R1848:Sdad1 UTSW 5 92,440,510 (GRCm39) critical splice donor site probably null
R2419:Sdad1 UTSW 5 92,453,677 (GRCm39) missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92,447,958 (GRCm39) missense probably benign 0.00
R2509:Sdad1 UTSW 5 92,453,684 (GRCm39) missense probably benign 0.12
R4043:Sdad1 UTSW 5 92,450,553 (GRCm39) missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92,446,116 (GRCm39) missense probably benign 0.01
R4477:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4749:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92,451,793 (GRCm39) missense probably benign 0.00
R5288:Sdad1 UTSW 5 92,434,684 (GRCm39) makesense probably null
R6331:Sdad1 UTSW 5 92,451,789 (GRCm39) missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92,446,049 (GRCm39) critical splice donor site probably null
R7099:Sdad1 UTSW 5 92,441,832 (GRCm39) missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92,453,596 (GRCm39) missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92,447,980 (GRCm39) missense probably benign 0.10
R7714:Sdad1 UTSW 5 92,450,538 (GRCm39) missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92,447,948 (GRCm39) missense probably benign 0.01
R8198:Sdad1 UTSW 5 92,439,811 (GRCm39) missense probably damaging 0.96
R8347:Sdad1 UTSW 5 92,446,088 (GRCm39) missense probably benign 0.00
R8693:Sdad1 UTSW 5 92,452,857 (GRCm39) missense probably benign 0.09
R8696:Sdad1 UTSW 5 92,437,645 (GRCm39) missense probably damaging 1.00
R8746:Sdad1 UTSW 5 92,437,784 (GRCm39) missense probably benign
R9004:Sdad1 UTSW 5 92,439,820 (GRCm39) missense probably benign 0.00
R9166:Sdad1 UTSW 5 92,446,080 (GRCm39) nonsense probably null
R9732:Sdad1 UTSW 5 92,438,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCGATGCAGAGTTTTCTTAC -3'
(R):5'- TAGACCCAGATCTCCGCATG -3'

Sequencing Primer
(F):5'- GCGATGCAGAGTTTTCTTACCAATC -3'
(R):5'- CCAGATCTCCGCATGGTAGGAAG -3'
Posted On 2015-11-11