Incidental Mutation 'R4734:Dennd5a'
ID 359161
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene Name DENN domain containing 5A
Synonyms Rab6ip1, 1500012B19Rik, ORF37
MMRRC Submission 041961-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R4734 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109492987-109559677 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109495543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1196 (R1196H)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
AlphaFold Q6PAL8
PDB Structure Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080437
AA Change: R1196H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: R1196H

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106722
AA Change: R1172H

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: R1172H

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156858
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,603,961 (GRCm39) M1V probably null Het
Abcb11 T A 2: 69,154,306 (GRCm39) T87S possibly damaging Het
Arap3 A G 18: 38,129,328 (GRCm39) V210A probably benign Het
Avl9 T C 6: 56,713,479 (GRCm39) S246P probably damaging Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Cdhr18 T C 14: 13,845,292 (GRCm38) N540S probably benign Het
Cfap96 A T 8: 46,423,454 (GRCm39) M86K possibly damaging Het
Chsy3 C A 18: 59,312,485 (GRCm39) F319L probably benign Het
Coro2b T C 9: 62,333,860 (GRCm39) T345A probably benign Het
Cpb1 A G 3: 20,317,876 (GRCm39) V216A probably benign Het
Cyp2c65 A G 19: 39,060,778 (GRCm39) I213V probably benign Het
Dcaf15 A G 8: 84,824,357 (GRCm39) C586R probably benign Het
Ddr2 T A 1: 169,825,657 (GRCm39) E314D probably benign Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dpf2 A G 19: 5,957,027 (GRCm39) probably null Het
Eif2ak4 A T 2: 118,252,568 (GRCm39) H302L probably damaging Het
Eif2d G T 1: 131,092,889 (GRCm39) R399L probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Fhod3 T A 18: 25,161,192 (GRCm39) Y575N probably benign Het
Fscb T C 12: 64,521,244 (GRCm39) E74G possibly damaging Het
Gdpd2 G A X: 99,777,799 (GRCm39) M243I possibly damaging Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gnl2 T C 4: 124,934,811 (GRCm39) F156L probably benign Het
Gpr37 C A 6: 25,689,085 (GRCm39) R4L possibly damaging Het
Hectd4 A T 5: 121,480,040 (GRCm39) H2892L possibly damaging Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Impact T A 18: 13,118,346 (GRCm39) H188Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lnx2 C T 5: 146,965,947 (GRCm39) G391R probably damaging Het
Lrrc19 T C 4: 94,526,586 (GRCm39) I324V probably benign Het
Lrrcc1 G T 3: 14,627,345 (GRCm39) Q458H probably damaging Het
Maml3 A T 3: 51,597,296 (GRCm39) D483E probably damaging Het
Mef2c T A 13: 83,810,748 (GRCm39) *467R probably null Het
Mms19 T A 19: 41,932,997 (GRCm39) S1031C probably damaging Het
Myt1l T C 12: 29,969,925 (GRCm39) I143T possibly damaging Het
Nuggc T C 14: 65,860,679 (GRCm39) Y426H probably damaging Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Oog2 T C 4: 143,923,021 (GRCm39) S429P probably benign Het
Or4d1 T A 11: 87,805,016 (GRCm39) T239S probably damaging Het
Or51f1 A G 7: 102,506,186 (GRCm39) I101T probably damaging Het
Or5p1 A T 7: 107,916,959 (GRCm39) N286I probably damaging Het
Or5p51 T C 7: 107,444,635 (GRCm39) I102V probably benign Het
Pcnt T C 10: 76,273,040 (GRCm39) D93G probably benign Het
Pdia5 A T 16: 35,276,883 (GRCm39) M95K probably benign Het
Pdzrn4 A T 15: 92,668,133 (GRCm39) R762* probably null Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Ppil3 A G 1: 58,470,428 (GRCm39) Y141H probably benign Het
Prb1c T A 6: 132,338,891 (GRCm39) N109I unknown Het
Rassf8 G T 6: 145,761,266 (GRCm39) K197N probably benign Het
Ryr2 T C 13: 11,752,639 (GRCm39) Q1894R probably damaging Het
Ryr3 T A 2: 112,740,847 (GRCm39) N487Y probably damaging Het
Scn5a T C 9: 119,368,604 (GRCm39) Y307C probably damaging Het
Sdad1 C T 5: 92,452,836 (GRCm39) R134Q possibly damaging Het
Shroom1 C T 11: 53,356,060 (GRCm39) S370F probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc2a9 C A 5: 38,539,442 (GRCm39) G353C probably damaging Het
Snx33 T A 9: 56,833,185 (GRCm39) T295S possibly damaging Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Supt6 T C 11: 78,115,509 (GRCm39) D761G probably benign Het
Tfeb T C 17: 48,096,787 (GRCm39) V18A probably benign Het
Thap12 G T 7: 98,365,161 (GRCm39) C443F probably damaging Het
Thap12 T A 7: 98,365,162 (GRCm39) C443* probably null Het
Tmem67 T C 4: 12,063,158 (GRCm39) D496G probably benign Het
Trappc8 G A 18: 20,974,629 (GRCm39) R900* probably null Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Trmt1l A T 1: 151,318,388 (GRCm39) I80L probably benign Het
Trpm5 C A 7: 142,636,522 (GRCm39) V472L probably benign Het
Tspear C T 10: 77,700,529 (GRCm39) L120F probably damaging Het
Ttc9b G A 7: 27,355,443 (GRCm39) V238M probably benign Het
Usp20 A G 2: 30,909,836 (GRCm39) I819V probably benign Het
Vmn2r102 T A 17: 19,897,795 (GRCm39) V270E probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 106,210,376 (GRCm39) probably null Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109,507,579 (GRCm39) missense probably benign
IGL01338:Dennd5a APN 7 109,518,611 (GRCm39) missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109,533,302 (GRCm39) missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109,533,991 (GRCm39) missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109,497,176 (GRCm39) missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109,532,844 (GRCm39) missense probably benign
IGL02697:Dennd5a APN 7 109,493,988 (GRCm39) missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109,520,514 (GRCm39) missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109,534,731 (GRCm39) missense probably benign
IGL03088:Dennd5a APN 7 109,507,588 (GRCm39) missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109,518,462 (GRCm39) splice site probably benign
IGL03181:Dennd5a APN 7 109,532,865 (GRCm39) missense probably damaging 1.00
big_pal UTSW 7 109,518,630 (GRCm39) nonsense probably null
Celestial UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109,532,831 (GRCm39) missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109,498,998 (GRCm39) missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109,498,998 (GRCm39) missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109,499,013 (GRCm39) missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109,533,961 (GRCm39) missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109,533,968 (GRCm39) missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109,520,633 (GRCm39) missense probably benign 0.01
R0811:Dennd5a UTSW 7 109,532,820 (GRCm39) missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109,532,820 (GRCm39) missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109,498,938 (GRCm39) missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109,533,961 (GRCm39) missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109,517,808 (GRCm39) missense probably benign
R1115:Dennd5a UTSW 7 109,517,968 (GRCm39) missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109,520,541 (GRCm39) nonsense probably null
R1300:Dennd5a UTSW 7 109,518,614 (GRCm39) missense probably benign
R1698:Dennd5a UTSW 7 109,516,587 (GRCm39) splice site probably null
R1711:Dennd5a UTSW 7 109,517,919 (GRCm39) missense probably benign 0.00
R1771:Dennd5a UTSW 7 109,517,893 (GRCm39) missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109,497,820 (GRCm39) missense probably benign 0.00
R2064:Dennd5a UTSW 7 109,497,900 (GRCm39) splice site probably benign
R2176:Dennd5a UTSW 7 109,504,327 (GRCm39) splice site probably null
R2182:Dennd5a UTSW 7 109,533,201 (GRCm39) missense probably benign 0.03
R2852:Dennd5a UTSW 7 109,532,878 (GRCm39) missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109,532,878 (GRCm39) missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109,520,559 (GRCm39) missense probably benign 0.00
R3835:Dennd5a UTSW 7 109,533,449 (GRCm39) missense probably benign 0.00
R3953:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3954:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3955:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R3957:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably benign 0.44
R4014:Dennd5a UTSW 7 109,534,688 (GRCm39) critical splice donor site probably null
R4166:Dennd5a UTSW 7 109,526,032 (GRCm39) critical splice donor site probably null
R4362:Dennd5a UTSW 7 109,495,550 (GRCm39) missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109,498,942 (GRCm39) missense probably benign 0.06
R4700:Dennd5a UTSW 7 109,520,405 (GRCm39) missense probably benign 0.01
R4914:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109,500,296 (GRCm39) missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109,493,919 (GRCm39) missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109,513,983 (GRCm39) missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109,513,983 (GRCm39) missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109,499,004 (GRCm39) missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109,532,936 (GRCm39) missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109,497,169 (GRCm39) missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109,533,447 (GRCm39) missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109,504,928 (GRCm39) missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109,518,630 (GRCm39) nonsense probably null
R5608:Dennd5a UTSW 7 109,518,630 (GRCm39) nonsense probably null
R5783:Dennd5a UTSW 7 109,493,843 (GRCm39) missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109,518,567 (GRCm39) missense probably benign 0.00
R5890:Dennd5a UTSW 7 109,533,428 (GRCm39) missense probably benign 0.00
R6053:Dennd5a UTSW 7 109,532,952 (GRCm39) missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109,497,889 (GRCm39) missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109,533,472 (GRCm39) nonsense probably null
R6446:Dennd5a UTSW 7 109,493,873 (GRCm39) missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109,500,325 (GRCm39) missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109,504,386 (GRCm39) missense probably benign 0.19
R7115:Dennd5a UTSW 7 109,493,961 (GRCm39) missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109,495,449 (GRCm39) critical splice donor site probably null
R7302:Dennd5a UTSW 7 109,504,906 (GRCm39) missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109,500,366 (GRCm39) missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109,496,174 (GRCm39) missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109,520,714 (GRCm39) missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109,533,196 (GRCm39) missense probably benign
R7873:Dennd5a UTSW 7 109,526,141 (GRCm39) missense probably damaging 1.00
R8124:Dennd5a UTSW 7 109,497,142 (GRCm39) missense probably damaging 1.00
R8309:Dennd5a UTSW 7 109,500,332 (GRCm39) missense probably damaging 1.00
R8345:Dennd5a UTSW 7 109,504,477 (GRCm39) missense possibly damaging 0.55
R8560:Dennd5a UTSW 7 109,533,898 (GRCm39) critical splice donor site probably null
R9104:Dennd5a UTSW 7 109,497,713 (GRCm39) critical splice donor site probably null
R9218:Dennd5a UTSW 7 109,507,592 (GRCm39) missense probably damaging 1.00
R9348:Dennd5a UTSW 7 109,498,942 (GRCm39) missense probably benign 0.00
R9348:Dennd5a UTSW 7 109,498,930 (GRCm39) critical splice donor site probably null
R9566:Dennd5a UTSW 7 109,533,254 (GRCm39) missense probably benign 0.01
R9608:Dennd5a UTSW 7 109,520,713 (GRCm39) missense probably damaging 1.00
R9756:Dennd5a UTSW 7 109,496,174 (GRCm39) missense possibly damaging 0.85
R9800:Dennd5a UTSW 7 109,500,374 (GRCm39) missense probably benign 0.40
Z1088:Dennd5a UTSW 7 109,504,480 (GRCm39) missense probably damaging 1.00
Z1088:Dennd5a UTSW 7 109,493,954 (GRCm39) missense possibly damaging 0.73
Z1177:Dennd5a UTSW 7 109,533,231 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCATCAAGATGTGGCCTC -3'
(R):5'- ACTTGCTTTGGTCTCCTGAAG -3'

Sequencing Primer
(F):5'- CATAAAGGGGCCCTCCAAGG -3'
(R):5'- CTTTGGTCTCCTGAAGTTGCTTG -3'
Posted On 2015-11-11