Mutagenetix > Incidental Mutation

Incidental Mutation 'R4734:Trpm5'

359162

Institutional Source

Beutler Lab

Gene Symbol

Trpm5

Ensembl Gene

ENSMUSG00000009246

Gene Name

transient receptor potential cation channel, subfamily M, member 5

Synonyms

9430099A16Rik, Mtr1, Ltrpc5

MMRRC Submission

041961-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R4734 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143069153-143094642 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 143082785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 472 (V472L)

Ref Sequence

ENSEMBL: ENSMUSP00000114302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]

AlphaFold

Q9JJH7

Predicted Effect

probably benign
Transcript: ENSMUST00000009390
AA Change: V472L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: V472L

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
Pfam:Ion_trans	736	989	1.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150589

Predicted Effect

probably benign
Transcript: ENSMUST00000150867
AA Change: V472L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: V472L

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
transmembrane domain	731	753	N/A	INTRINSIC
transmembrane domain	811	833	N/A	INTRINSIC
transmembrane domain	872	894	N/A	INTRINSIC
transmembrane domain	952	974	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,417	M86K	possibly damaging	Het
2700062C07Rik	A	G	18: 24,470,904	M1V	probably null	Het
Abcb11	T	A	2: 69,323,962	T87S	possibly damaging	Het
Arap3	A	G	18: 37,996,275	V210A	probably benign	Het
Avl9	T	C	6: 56,736,494	S246P	probably damaging	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Chsy3	C	A	18: 59,179,413	F319L	probably benign	Het
Coro2b	T	C	9: 62,426,578	T345A	probably benign	Het
Cpb1	A	G	3: 20,263,712	V216A	probably benign	Het
Cyp2c65	A	G	19: 39,072,334	I213V	probably benign	Het
Dcaf15	A	G	8: 84,097,728	C586R	probably benign	Het
Ddr2	T	A	1: 169,998,088	E314D	probably benign	Het
Dennd5a	C	T	7: 109,896,336	R1196H	probably damaging	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dpf2	A	G	19: 5,906,999		probably null	Het
Eif2ak4	A	T	2: 118,422,087	H302L	probably damaging	Het
Eif2d	G	T	1: 131,165,152	R399L	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Fhod3	T	A	18: 25,028,135	Y575N	probably benign	Het
Fscb	T	C	12: 64,474,470	E74G	possibly damaging	Het
Gdpd2	G	A	X: 100,734,193	M243I	possibly damaging	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gm281	T	C	14: 13,845,292	N540S	probably benign	Het
Gm8882	T	A	6: 132,361,928	N109I	unknown	Het
Gnl2	T	C	4: 125,041,018	F156L	probably benign	Het
Gpr37	C	A	6: 25,689,086	R4L	possibly damaging	Het
Hectd4	A	T	5: 121,341,977	H2892L	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Impact	T	A	18: 12,985,289	H188Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnx2	C	T	5: 147,029,137	G391R	probably damaging	Het
Lrrc19	T	C	4: 94,638,349	I324V	probably benign	Het
Lrrcc1	G	T	3: 14,562,285	Q458H	probably damaging	Het
Maml3	A	T	3: 51,689,875	D483E	probably damaging	Het
Mef2c	T	A	13: 83,662,629	*467R	probably null	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Myt1l	T	C	12: 29,919,926	I143T	possibly damaging	Het
Nuggc	T	C	14: 65,623,230	Y426H	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr464	T	A	11: 87,914,190	T239S	probably damaging	Het
Olfr470	T	C	7: 107,845,428	I102V	probably benign	Het
Olfr491	A	T	7: 108,317,752	N286I	probably damaging	Het
Olfr566	A	G	7: 102,856,979	I101T	probably damaging	Het
Oog2	T	C	4: 144,196,451	S429P	probably benign	Het
Pcnt	T	C	10: 76,437,206	D93G	probably benign	Het
Pdia5	A	T	16: 35,456,513	M95K	probably benign	Het
Pdzrn4	A	T	15: 92,770,252	R762*	probably null	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Ppil3	A	G	1: 58,431,269	Y141H	probably benign	Het
Rassf8	G	T	6: 145,815,540	K197N	probably benign	Het
Ryr2	T	C	13: 11,737,753	Q1894R	probably damaging	Het
Ryr3	T	A	2: 112,910,502	N487Y	probably damaging	Het
Scn5a	T	C	9: 119,539,538	Y307C	probably damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Shroom1	C	T	11: 53,465,233	S370F	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc2a9	C	A	5: 38,382,099	G353C	probably damaging	Het
Snx33	T	A	9: 56,925,901	T295S	possibly damaging	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Supt6	T	C	11: 78,224,683	D761G	probably benign	Het
Tfeb	T	C	17: 47,785,862	V18A	probably benign	Het
Thap12	G	T	7: 98,715,954	C443F	probably damaging	Het
Thap12	T	A	7: 98,715,955	C443*	probably null	Het
Tmem67	T	C	4: 12,063,158	D496G	probably benign	Het
Trappc8	G	A	18: 20,841,572	R900*	probably null	Het
Trim9	T	C	12: 70,248,273	N688D	probably damaging	Het
Trmt1l	A	T	1: 151,442,637	I80L	probably benign	Het
Tspear	C	T	10: 77,864,695	L120F	probably damaging	Het
Ttc9b	G	A	7: 27,656,018	V238M	probably benign	Het
Usp20	A	G	2: 31,019,824	I819V	probably benign	Het
Vmn2r102	T	A	17: 19,677,533	V270E	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het

Other mutations in Trpm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Trpm5	APN	7	143082991	missense	probably benign	0.03
IGL00717:Trpm5	APN	7	143073990	missense	probably damaging	1.00
IGL01138:Trpm5	APN	7	143074569	missense	probably benign
IGL01590:Trpm5	APN	7	143082734	missense	probably damaging	0.99
IGL01603:Trpm5	APN	7	143075601	missense	probably benign	0.04
IGL01685:Trpm5	APN	7	143082354	missense	probably benign	0.05
IGL01878:Trpm5	APN	7	143074497	missense	probably damaging	1.00
IGL02533:Trpm5	APN	7	143089545	missense	probably benign	0.01
IGL02572:Trpm5	APN	7	143087876	splice site	probably benign
IGL02750:Trpm5	APN	7	143074484	missense	possibly damaging	0.89
IGL02862:Trpm5	APN	7	143082525	missense	probably damaging	1.00
R0032:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0334:Trpm5	UTSW	7	143086876	missense	probably benign	0.06
R0799:Trpm5	UTSW	7	143078351	missense	probably damaging	0.99
R1187:Trpm5	UTSW	7	143074469	missense	probably damaging	0.96
R1373:Trpm5	UTSW	7	143086842	splice site	probably benign
R1521:Trpm5	UTSW	7	143082889	missense	probably benign	0.00
R1603:Trpm5	UTSW	7	143085209	missense	probably benign	0.00
R1606:Trpm5	UTSW	7	143085171	nonsense	probably null
R2009:Trpm5	UTSW	7	143087738	missense	possibly damaging	0.58
R2437:Trpm5	UTSW	7	143082561	missense	probably benign	0.03
R2508:Trpm5	UTSW	7	143088919	missense	possibly damaging	0.80
R2516:Trpm5	UTSW	7	143074517	missense	probably damaging	1.00
R2985:Trpm5	UTSW	7	143082938	missense	probably damaging	0.99
R3036:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3037:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3688:Trpm5	UTSW	7	143078456	missense	probably damaging	0.98
R4156:Trpm5	UTSW	7	143089055	missense	probably benign	0.04
R4811:Trpm5	UTSW	7	143080219	missense	probably damaging	1.00
R4814:Trpm5	UTSW	7	143082636	missense	possibly damaging	0.50
R4847:Trpm5	UTSW	7	143087763	missense	possibly damaging	0.89
R5055:Trpm5	UTSW	7	143072784	missense	probably benign	0.00
R5256:Trpm5	UTSW	7	143082303	missense	probably damaging	1.00
R5413:Trpm5	UTSW	7	143080968	missense	probably damaging	1.00
R5668:Trpm5	UTSW	7	143073229	missense	probably benign	0.39
R6133:Trpm5	UTSW	7	143088951	missense	probably damaging	0.98
R6242:Trpm5	UTSW	7	143073182	missense	probably benign
R6564:Trpm5	UTSW	7	143072770	missense	probably damaging	1.00
R6702:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6703:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6829:Trpm5	UTSW	7	143069429	unclassified	probably benign
R6940:Trpm5	UTSW	7	143084810	nonsense	probably null
R7337:Trpm5	UTSW	7	143089019	missense	probably benign	0.01
R7513:Trpm5	UTSW	7	143081835	missense	possibly damaging	0.84
R7560:Trpm5	UTSW	7	143080986	missense	probably damaging	1.00
R7801:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R7961:Trpm5	UTSW	7	143080369	missense	probably benign	0.00
R8009:Trpm5	UTSW	7	143080369	missense	probably benign	0.00
R8189:Trpm5	UTSW	7	143081838	missense	probably benign	0.32
R8441:Trpm5	UTSW	7	143072434	missense	possibly damaging	0.75
R8507:Trpm5	UTSW	7	143078313	missense	probably damaging	1.00
R8825:Trpm5	UTSW	7	143083016	missense	possibly damaging	0.94
R9443:Trpm5	UTSW	7	143085123	missense	probably benign
R9577:Trpm5	UTSW	7	143079394	critical splice donor site	probably null
R9608:Trpm5	UTSW	7	143079411	missense	possibly damaging	0.83
R9647:Trpm5	UTSW	7	143080761	missense	possibly damaging	0.95
X0022:Trpm5	UTSW	7	143083042	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTTCCTACTGAGGTCTGGCAG -3'
(R):5'- ACAAGCCTGACTTTGTCCGC -3'

Sequencing Primer
(F):5'- TGAGGTCTGGCAGCCACTTC -3'
(R):5'- ACATGGCCGAGTTCTTGAC -3'

Posted On

2015-11-11