Incidental Mutation 'R4734:Or4d1'
ID 359184
Institutional Source Beutler Lab
Gene Symbol Or4d1
Ensembl Gene ENSMUSG00000060787
Gene Name olfactory receptor family 4 subfamily D member 1
Synonyms MOR240-2, Olfr464, GA_x6K02T2PAEV-9555122-9554181
MMRRC Submission 041961-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R4734 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87804746-87805829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87805016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 239 (T239S)
Ref Sequence ENSEMBL: ENSMUSP00000149264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074874] [ENSMUST00000216461] [ENSMUST00000217112]
AlphaFold Q5SW48
Predicted Effect probably damaging
Transcript: ENSMUST00000074874
AA Change: T239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074415
Gene: ENSMUSG00000060787
AA Change: T239S

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.3e-42 PFAM
Pfam:7tm_1 41 287 3.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215062
Predicted Effect probably damaging
Transcript: ENSMUST00000216461
AA Change: T239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217112
AA Change: T239S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,603,961 (GRCm39) M1V probably null Het
Abcb11 T A 2: 69,154,306 (GRCm39) T87S possibly damaging Het
Arap3 A G 18: 38,129,328 (GRCm39) V210A probably benign Het
Avl9 T C 6: 56,713,479 (GRCm39) S246P probably damaging Het
Ccdc88a A G 11: 29,432,720 (GRCm39) K222R probably benign Het
Cdhr18 T C 14: 13,845,292 (GRCm38) N540S probably benign Het
Cfap96 A T 8: 46,423,454 (GRCm39) M86K possibly damaging Het
Chsy3 C A 18: 59,312,485 (GRCm39) F319L probably benign Het
Coro2b T C 9: 62,333,860 (GRCm39) T345A probably benign Het
Cpb1 A G 3: 20,317,876 (GRCm39) V216A probably benign Het
Cyp2c65 A G 19: 39,060,778 (GRCm39) I213V probably benign Het
Dcaf15 A G 8: 84,824,357 (GRCm39) C586R probably benign Het
Ddr2 T A 1: 169,825,657 (GRCm39) E314D probably benign Het
Dennd5a C T 7: 109,495,543 (GRCm39) R1196H probably damaging Het
Dnah9 G A 11: 65,724,941 (GRCm39) A4404V probably damaging Het
Dpf2 A G 19: 5,957,027 (GRCm39) probably null Het
Eif2ak4 A T 2: 118,252,568 (GRCm39) H302L probably damaging Het
Eif2d G T 1: 131,092,889 (GRCm39) R399L probably damaging Het
Fat2 A G 11: 55,202,294 (GRCm39) V260A probably benign Het
Fhod3 T A 18: 25,161,192 (GRCm39) Y575N probably benign Het
Fscb T C 12: 64,521,244 (GRCm39) E74G possibly damaging Het
Gdpd2 G A X: 99,777,799 (GRCm39) M243I possibly damaging Het
Glra1 C A 11: 55,427,210 (GRCm39) D42Y probably damaging Het
Gnl2 T C 4: 124,934,811 (GRCm39) F156L probably benign Het
Gpr37 C A 6: 25,689,085 (GRCm39) R4L possibly damaging Het
Hectd4 A T 5: 121,480,040 (GRCm39) H2892L possibly damaging Het
Helb T C 10: 119,920,754 (GRCm39) D1063G probably benign Het
Htr2c A G X: 145,976,793 (GRCm39) T163A probably benign Het
Impact T A 18: 13,118,346 (GRCm39) H188Q probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lnx2 C T 5: 146,965,947 (GRCm39) G391R probably damaging Het
Lrrc19 T C 4: 94,526,586 (GRCm39) I324V probably benign Het
Lrrcc1 G T 3: 14,627,345 (GRCm39) Q458H probably damaging Het
Maml3 A T 3: 51,597,296 (GRCm39) D483E probably damaging Het
Mef2c T A 13: 83,810,748 (GRCm39) *467R probably null Het
Mms19 T A 19: 41,932,997 (GRCm39) S1031C probably damaging Het
Myt1l T C 12: 29,969,925 (GRCm39) I143T possibly damaging Het
Nuggc T C 14: 65,860,679 (GRCm39) Y426H probably damaging Het
Oit3 A T 10: 59,259,904 (GRCm39) C500S probably damaging Het
Oog2 T C 4: 143,923,021 (GRCm39) S429P probably benign Het
Or51f1 A G 7: 102,506,186 (GRCm39) I101T probably damaging Het
Or5p1 A T 7: 107,916,959 (GRCm39) N286I probably damaging Het
Or5p51 T C 7: 107,444,635 (GRCm39) I102V probably benign Het
Pcnt T C 10: 76,273,040 (GRCm39) D93G probably benign Het
Pdia5 A T 16: 35,276,883 (GRCm39) M95K probably benign Het
Pdzrn4 A T 15: 92,668,133 (GRCm39) R762* probably null Het
Piezo1 G T 8: 123,224,945 (GRCm39) Q654K probably damaging Het
Ppil3 A G 1: 58,470,428 (GRCm39) Y141H probably benign Het
Prb1c T A 6: 132,338,891 (GRCm39) N109I unknown Het
Rassf8 G T 6: 145,761,266 (GRCm39) K197N probably benign Het
Ryr2 T C 13: 11,752,639 (GRCm39) Q1894R probably damaging Het
Ryr3 T A 2: 112,740,847 (GRCm39) N487Y probably damaging Het
Scn5a T C 9: 119,368,604 (GRCm39) Y307C probably damaging Het
Sdad1 C T 5: 92,452,836 (GRCm39) R134Q possibly damaging Het
Shroom1 C T 11: 53,356,060 (GRCm39) S370F probably damaging Het
Slc29a3 A G 10: 60,552,105 (GRCm39) V313A probably benign Het
Slc2a9 C A 5: 38,539,442 (GRCm39) G353C probably damaging Het
Snx33 T A 9: 56,833,185 (GRCm39) T295S possibly damaging Het
Spata31d1b G A 13: 59,866,172 (GRCm39) V1107M probably damaging Het
Supt6 T C 11: 78,115,509 (GRCm39) D761G probably benign Het
Tfeb T C 17: 48,096,787 (GRCm39) V18A probably benign Het
Thap12 G T 7: 98,365,161 (GRCm39) C443F probably damaging Het
Thap12 T A 7: 98,365,162 (GRCm39) C443* probably null Het
Tmem67 T C 4: 12,063,158 (GRCm39) D496G probably benign Het
Trappc8 G A 18: 20,974,629 (GRCm39) R900* probably null Het
Trim9 T C 12: 70,295,047 (GRCm39) N688D probably damaging Het
Trmt1l A T 1: 151,318,388 (GRCm39) I80L probably benign Het
Trpm5 C A 7: 142,636,522 (GRCm39) V472L probably benign Het
Tspear C T 10: 77,700,529 (GRCm39) L120F probably damaging Het
Ttc9b G A 7: 27,355,443 (GRCm39) V238M probably benign Het
Usp20 A G 2: 30,909,836 (GRCm39) I819V probably benign Het
Vmn2r102 T A 17: 19,897,795 (GRCm39) V270E probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Zc3h18 A T 8: 123,110,382 (GRCm39) D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 106,210,376 (GRCm39) probably null Het
Other mutations in Or4d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Or4d1 APN 11 87,804,998 (GRCm39) missense probably benign 0.09
IGL02011:Or4d1 APN 11 87,805,708 (GRCm39) missense probably benign 0.01
IGL02218:Or4d1 APN 11 87,804,889 (GRCm39) missense probably damaging 1.00
IGL02977:Or4d1 APN 11 87,804,956 (GRCm39) missense possibly damaging 0.48
IGL03083:Or4d1 APN 11 87,804,914 (GRCm39) missense probably benign 0.00
IGL03154:Or4d1 APN 11 87,805,072 (GRCm39) missense possibly damaging 0.90
R0241:Or4d1 UTSW 11 87,804,860 (GRCm39) missense probably damaging 1.00
R0241:Or4d1 UTSW 11 87,804,860 (GRCm39) missense probably damaging 1.00
R4679:Or4d1 UTSW 11 87,805,136 (GRCm39) missense probably benign 0.13
R4939:Or4d1 UTSW 11 87,804,950 (GRCm39) missense probably damaging 1.00
R5917:Or4d1 UTSW 11 87,805,215 (GRCm39) missense probably damaging 1.00
R6729:Or4d1 UTSW 11 87,805,676 (GRCm39) nonsense probably null
R8289:Or4d1 UTSW 11 87,805,589 (GRCm39) missense probably benign 0.07
R8328:Or4d1 UTSW 11 87,804,985 (GRCm39) missense possibly damaging 0.50
R8363:Or4d1 UTSW 11 87,805,069 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTCCTGGTTCCTGAG -3'
(R):5'- CGATTGTCCAGCTGTCTCTGATG -3'

Sequencing Primer
(F):5'- CCTGAGCGTGTAGATCATGG -3'
(R):5'- CTGTGATGTCCCCCAAGTACTGAG -3'
Posted On 2015-11-11