Mutagenetix > Incidental Mutations

Incidental Mutation 'R4734:Trim9'

359188

Institutional Source

Beutler Lab

Gene Symbol

Trim9

Ensembl Gene

ENSMUSG00000021071

Gene Name

tripartite motif-containing 9

Synonyms

MMRRC Submission

041961-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.290) question?

Stock #

R4734 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70244533-70347614 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70248273 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 688 (N688D)

Ref Sequence

ENSEMBL: ENSMUSP00000152887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110520
AA Change: N692D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: N692D

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
Pfam:SPRY	598	702	2.4e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110522
AA Change: N766D

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: N766D

Domain	Start	End	E-Value	Type
RING	10	131	1.23e-4	SMART
BBOX	163	212	2.84e-9	SMART
BBOX	224	266	9.89e-9	SMART
BBC	273	399	1.29e-38	SMART
FN3	439	522	4.09e-7	SMART
low complexity region	591	605	N/A	INTRINSIC
Pfam:SPRY	674	776	1.5e-9	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000221294
AA Change: N738D

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222173

Predicted Effect

probably damaging
Transcript: ENSMUST00000222316
AA Change: N784D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223160
AA Change: N688D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223518

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,970,417	M86K	possibly damaging	Het
2700062C07Rik	A	G	18: 24,470,904	M1V	probably null	Het
Abcb11	T	A	2: 69,323,962	T87S	possibly damaging	Het
Arap3	A	G	18: 37,996,275	V210A	probably benign	Het
Avl9	T	C	6: 56,736,494	S246P	probably damaging	Het
Ccdc88a	A	G	11: 29,482,720	K222R	probably benign	Het
Chsy3	C	A	18: 59,179,413	F319L	probably benign	Het
Coro2b	T	C	9: 62,426,578	T345A	probably benign	Het
Cpb1	A	G	3: 20,263,712	V216A	probably benign	Het
Cyp2c65	A	G	19: 39,072,334	I213V	probably benign	Het
Dcaf15	A	G	8: 84,097,728	C586R	probably benign	Het
Ddr2	T	A	1: 169,998,088	E314D	probably benign	Het
Dennd5a	C	T	7: 109,896,336	R1196H	probably damaging	Het
Dnah9	G	A	11: 65,834,115	A4404V	probably damaging	Het
Dpf2	A	G	19: 5,906,999		probably null	Het
Eif2ak4	A	T	2: 118,422,087	H302L	probably damaging	Het
Eif2d	G	T	1: 131,165,152	R399L	probably damaging	Het
Fat2	A	G	11: 55,311,468	V260A	probably benign	Het
Fhod3	T	A	18: 25,028,135	Y575N	probably benign	Het
Fscb	T	C	12: 64,474,470	E74G	possibly damaging	Het
Gdpd2	G	A	X: 100,734,193	M243I	possibly damaging	Het
Glra1	C	A	11: 55,536,384	D42Y	probably damaging	Het
Gm281	T	C	14: 13,845,292	N540S	probably benign	Het
Gm8882	T	A	6: 132,361,928	N109I	unknown	Het
Gnl2	T	C	4: 125,041,018	F156L	probably benign	Het
Gpr37	C	A	6: 25,689,086	R4L	possibly damaging	Het
Hectd4	A	T	5: 121,341,977	H2892L	possibly damaging	Het
Helb	T	C	10: 120,084,849	D1063G	probably benign	Het
Htr2c	A	G	X: 147,193,797	T163A	probably benign	Het
Impact	T	A	18: 12,985,289	H188Q	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnx2	C	T	5: 147,029,137	G391R	probably damaging	Het
Lrrc19	T	C	4: 94,638,349	I324V	probably benign	Het
Lrrcc1	G	T	3: 14,562,285	Q458H	probably damaging	Het
Maml3	A	T	3: 51,689,875	D483E	probably damaging	Het
Mef2c	T	A	13: 83,662,629	*467R	probably null	Het
Mms19	T	A	19: 41,944,558	S1031C	probably damaging	Het
Myt1l	T	C	12: 29,919,926	I143T	possibly damaging	Het
Nuggc	T	C	14: 65,623,230	Y426H	probably damaging	Het
Oit3	A	T	10: 59,424,082	C500S	probably damaging	Het
Olfr464	T	A	11: 87,914,190	T239S	probably damaging	Het
Olfr470	T	C	7: 107,845,428	I102V	probably benign	Het
Olfr491	A	T	7: 108,317,752	N286I	probably damaging	Het
Olfr566	A	G	7: 102,856,979	I101T	probably damaging	Het
Oog2	T	C	4: 144,196,451	S429P	probably benign	Het
Pcnt	T	C	10: 76,437,206	D93G	probably benign	Het
Pdia5	A	T	16: 35,456,513	M95K	probably benign	Het
Pdzrn4	A	T	15: 92,770,252	R762*	probably null	Het
Piezo1	G	T	8: 122,498,206	Q654K	probably damaging	Het
Ppil3	A	G	1: 58,431,269	Y141H	probably benign	Het
Rassf8	G	T	6: 145,815,540	K197N	probably benign	Het
Ryr2	T	C	13: 11,737,753	Q1894R	probably damaging	Het
Ryr3	T	A	2: 112,910,502	N487Y	probably damaging	Het
Scn5a	T	C	9: 119,539,538	Y307C	probably damaging	Het
Sdad1	C	T	5: 92,304,977	R134Q	possibly damaging	Het
Shroom1	C	T	11: 53,465,233	S370F	probably damaging	Het
Slc29a3	A	G	10: 60,716,326	V313A	probably benign	Het
Slc2a9	C	A	5: 38,382,099	G353C	probably damaging	Het
Snx33	T	A	9: 56,925,901	T295S	possibly damaging	Het
Spata31d1b	G	A	13: 59,718,358	V1107M	probably damaging	Het
Supt6	T	C	11: 78,224,683	D761G	probably benign	Het
Tfeb	T	C	17: 47,785,862	V18A	probably benign	Het
Thap12	G	T	7: 98,715,954	C443F	probably damaging	Het
Thap12	T	A	7: 98,715,955	C443*	probably null	Het
Tmem67	T	C	4: 12,063,158	D496G	probably benign	Het
Trappc8	G	A	18: 20,841,572	R900*	probably null	Het
Trmt1l	A	T	1: 151,442,637	I80L	probably benign	Het
Trpm5	C	A	7: 143,082,785	V472L	probably benign	Het
Tspear	C	T	10: 77,864,695	L120F	probably damaging	Het
Ttc9b	G	A	7: 27,656,018	V238M	probably benign	Het
Usp20	A	G	2: 31,019,824	I819V	probably benign	Het
Vmn2r102	T	A	17: 19,677,533	V270E	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zc3h18	A	T	8: 122,383,643	D77V	probably damaging	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het

Other mutations in Trim9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Trim9	APN	12	70347113	missense	probably damaging	0.98
IGL01618:Trim9	APN	12	70248351	missense	probably benign
IGL01794:Trim9	APN	12	70281880	missense	probably damaging	1.00
IGL03101:Trim9	APN	12	70346654	missense	probably damaging	1.00
IGL03184:Trim9	APN	12	70251221	missense	probably damaging	0.99
E0354:Trim9	UTSW	12	70272459	missense	probably benign	0.01
IGL03098:Trim9	UTSW	12	70280693	missense	possibly damaging	0.95
R0518:Trim9	UTSW	12	70346585	missense	probably damaging	0.99
R0622:Trim9	UTSW	12	70346604	missense	probably damaging	1.00
R0941:Trim9	UTSW	12	70248263	missense	probably damaging	0.97
R1022:Trim9	UTSW	12	70252017	splice site	probably null
R1024:Trim9	UTSW	12	70252017	splice site	probably null
R1204:Trim9	UTSW	12	70346727	missense	probably damaging	1.00
R1439:Trim9	UTSW	12	70251093	missense	probably damaging	1.00
R1530:Trim9	UTSW	12	70272428	missense	probably damaging	0.98
R1613:Trim9	UTSW	12	70248395	missense	probably damaging	1.00
R1661:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1665:Trim9	UTSW	12	70255113	missense	probably damaging	0.99
R1722:Trim9	UTSW	12	70248374	missense	probably benign	0.33
R2097:Trim9	UTSW	12	70347159	missense	probably damaging	1.00
R3082:Trim9	UTSW	12	70255113	missense	possibly damaging	0.93
R3123:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3124:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3125:Trim9	UTSW	12	70248393	missense	probably damaging	1.00
R3738:Trim9	UTSW	12	70251195	missense	probably damaging	1.00
R4013:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4017:Trim9	UTSW	12	70346352	missense	probably damaging	1.00
R4560:Trim9	UTSW	12	70347118	nonsense	probably null
R4748:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4749:Trim9	UTSW	12	70248273	missense	probably damaging	1.00
R4777:Trim9	UTSW	12	70347071	missense	probably damaging	1.00
R5027:Trim9	UTSW	12	70346708	missense	probably damaging	0.96
R5451:Trim9	UTSW	12	70346829	missense	probably benign	0.17
R5471:Trim9	UTSW	12	70346792	missense	possibly damaging	0.93
R6394:Trim9	UTSW	12	70255213	missense	possibly damaging	0.91
R6901:Trim9	UTSW	12	70346639	missense	probably damaging	0.96
R7549:Trim9	UTSW	12	70346941	missense	probably damaging	1.00
R7690:Trim9	UTSW	12	70248343	missense	probably benign
R7895:Trim9	UTSW	12	70255187	missense	probably benign	0.03
R8003:Trim9	UTSW	12	70346834	missense	probably benign	0.39
R8026:Trim9	UTSW	12	70290387	missense	probably benign	0.00
R8223:Trim9	UTSW	12	70251015	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGCCAGTCTGTTGAAGTC -3'
(R):5'- TCCCTTTTCCCACAGAACTGAAG -3'

Sequencing Primer
(F):5'- CAGCCAGTCTGTTGAAGTCATTCAG -3'
(R):5'- TTTTCCCACAGAACTGAAGGAGGG -3'

Posted On

2015-11-11