Incidental Mutation 'R4736:1110002E22Rik'
ID359226
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R4736 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138068485 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1145 (I1145T)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: I1145T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: I1145T

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCGAGACAAGTCCAAGG -3'
(R):5'- TGGAGACAATCTTGAGCACAGG -3'

Sequencing Primer
(F):5'- GAGACAAGTCCAAGGCCTCG -3'
(R):5'- CCTTGCTCAGATTTATTGGGAGC -3'
Posted On2015-11-11