Incidental Mutation 'R4736:Cabp5'
ID 359245
Institutional Source Beutler Lab
Gene Symbol Cabp5
Ensembl Gene ENSMUSG00000005649
Gene Name calcium binding protein 5
Synonyms
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4736 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 13398132-13408887 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 13400739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005791] [ENSMUST00000117400] [ENSMUST00000152995]
AlphaFold Q9JLK3
Predicted Effect probably null
Transcript: ENSMUST00000005791
SMART Domains Protein: ENSMUSP00000005791
Gene: ENSMUSG00000005649

DomainStartEndE-ValueType
EFh 32 60 1.24e-6 SMART
Blast:EFh 71 96 8e-8 BLAST
EFh 109 137 7.75e-8 SMART
EFh 146 173 4.06e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117400
SMART Domains Protein: ENSMUSP00000112415
Gene: ENSMUSG00000005649

DomainStartEndE-ValueType
EFh 32 60 1.24e-6 SMART
Blast:EFh 71 96 8e-8 BLAST
EFh 109 137 7.75e-8 SMART
EFh 146 172 1.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152995
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of this gene is retina-specific. The mouse homolog of this protein has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of this gene is unknown. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Cabp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Cabp5 APN 7 13405487 missense probably damaging 1.00
IGL01621:Cabp5 APN 7 13401264 missense probably damaging 1.00
IGL02391:Cabp5 APN 7 13398344 nonsense probably null
IGL02712:Cabp5 APN 7 13403346 missense probably damaging 1.00
R0565:Cabp5 UTSW 7 13401335 missense probably damaging 0.99
R1231:Cabp5 UTSW 7 13405425 missense probably damaging 1.00
R1482:Cabp5 UTSW 7 13398342 nonsense probably null
R6036:Cabp5 UTSW 7 13401335 missense probably damaging 0.99
R6036:Cabp5 UTSW 7 13401335 missense probably damaging 0.99
R7162:Cabp5 UTSW 7 13401335 missense probably damaging 0.99
R7769:Cabp5 UTSW 7 13400733 missense probably benign 0.00
R7810:Cabp5 UTSW 7 13398338 missense possibly damaging 0.90
R8012:Cabp5 UTSW 7 13407781 critical splice acceptor site probably null
R8238:Cabp5 UTSW 7 13405452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTAGAGAAGAGCTGGGGATG -3'
(R):5'- GCATCATTTCCAAGTCCCTGT -3'

Sequencing Primer
(F):5'- ATGGGAGTTGTATTAGAGGGAGG -3'
(R):5'- GTCCCTGTGACTTATGCAAATGAGAC -3'
Posted On 2015-11-11