Incidental Mutation 'R4736:Scube2'
ID 359251
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock # R4736 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109831205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 455 (V455A)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: V455A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: V455A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: V455A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: V455A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTTGTCAAGAAGCATCTGG -3'
(R):5'- ACACAGCAGACTTGTGCCTC -3'

Sequencing Primer
(F):5'- TTGTCAAGAAGCATCTGGTCCAG -3'
(R):5'- TCTCTAACCTTCATAGGAGGCAAGG -3'
Posted On 2015-11-11