Incidental Mutation 'R4736:Myo9b'
ID359257
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Namemyosin IXb
Synonyms
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R4736 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71272714-71360713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71356592 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1815 (L1815P)
Ref Sequence ENSEMBL: ENSMUSP00000148316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: L1813P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: L1813P

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: L1827P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: L1827P

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: L1827P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: L1827P

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212412
AA Change: L622P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212935
AA Change: L1815P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2037:Myo9b UTSW 8 71290866 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATGCAGTCCTGGACCAC -3'
(R):5'- TGTAGCTGGCCTGGAAGTTC -3'

Sequencing Primer
(F):5'- GGAGCGACTCATCTTCCAC -3'
(R):5'- GGAAGTTCAGATTCTCCTGCCTAG -3'
Posted On2015-11-11