Mutagenetix > Incidental Mutation

Incidental Mutation 'R4736:Itgae'

359274

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

041963-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4736 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73114880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 290 (R290L)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006101
AA Change: R290L

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: R290L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102537
AA Change: R290L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: R290L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,068,485	I1145T	probably damaging	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abhd16a	A	T	17: 35,101,883	T436S	probably benign	Het
Acbd5	G	T	2: 23,099,584	L406F	probably damaging	Het
Agrn	G	A	4: 156,172,401	T1142M	probably benign	Het
Aig1	C	A	10: 13,801,930	W106L	probably damaging	Het
Akr1d1	T	C	6: 37,557,600		probably null	Het
Ap1g1	G	A	8: 109,855,082	D658N	possibly damaging	Het
Arhgap45	A	G	10: 80,026,172	Y520C	probably damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Asic5	C	T	3: 81,999,809	T47I	possibly damaging	Het
BC052040	A	G	2: 115,581,888	I2V	probably benign	Het
Cabp5	A	G	7: 13,400,739		probably null	Het
Ccr6	A	T	17: 8,256,064	R34*	probably null	Het
Clec4a2	T	C	6: 123,140,663	I180T	probably damaging	Het
Cmtr1	A	G	17: 29,700,242	E704G	possibly damaging	Het
Cyth3	G	A	5: 143,684,479		probably null	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Dennd6b	T	C	15: 89,185,592	H468R	probably benign	Het
Depdc5	A	G	5: 32,975,322	M1237V	probably benign	Het
Dpp6	A	G	5: 27,712,659	Y616C	probably damaging	Het
Dync2h1	A	T	9: 7,006,862	S3710T	probably benign	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Emc3	G	A	6: 113,531,349	T45I	possibly damaging	Het
Esf1	T	A	2: 140,124,971	D685V	probably damaging	Het
Ezr	A	G	17: 6,741,576	S366P	probably benign	Het
Gbe1	C	T	16: 70,495,253	A491V	probably damaging	Het
Haus6	A	G	4: 86,600,749		probably null	Het
Heca	G	A	10: 17,915,187	Q12*	probably null	Het
Hpdl	T	C	4: 116,821,024	N80S	probably damaging	Het
Hydin	A	T	8: 110,523,208	Q2261L	probably benign	Het
Kcna10	C	A	3: 107,195,492	L480I	probably benign	Het
Kif27	T	C	13: 58,328,971	T622A	probably benign	Het
Lama2	T	C	10: 27,204,929	N966S	probably damaging	Het
Mdfic	A	G	6: 15,741,020	K38E	possibly damaging	Het
Med25	G	A	7: 44,892,288	A26V	probably damaging	Het
Mrpl19	A	T	6: 81,964,348	S77R	probably damaging	Het
Mybpc2	T	C	7: 44,512,547	D493G	probably damaging	Het
Myh4	A	G	11: 67,240,920	T69A	probably benign	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo9b	T	C	8: 71,356,592	L1815P	probably damaging	Het
Myom2	T	A	8: 15,081,271	L323Q	probably damaging	Het
Naip1	T	C	13: 100,444,526	D71G	possibly damaging	Het
Nktr	T	A	9: 121,749,739		probably benign	Het
Nol10	A	G	12: 17,355,287	K88E	probably damaging	Het
Nol4	T	C	18: 22,718,993	D505G	probably damaging	Het
Nynrin	T	A	14: 55,863,997	N374K	probably damaging	Het
Obscn	A	T	11: 59,063,536	L3740Q	probably damaging	Het
Olfr1000	T	C	2: 85,607,983	H309R	probably benign	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pgm5	G	A	19: 24,834,805	A121V	probably damaging	Het
Pi4ka	A	T	16: 17,377,175	Y120N	probably benign	Het
Rpl36al	G	A	12: 69,182,958	A60V	possibly damaging	Het
Rspo4	T	C	2: 151,843,134	Y21H	probably benign	Het
Scube2	A	G	7: 109,831,205	V455A	probably benign	Het
Serpina1f	T	C	12: 103,693,546	D159G	probably damaging	Het
Sf1	A	G	19: 6,365,664	D11G	probably damaging	Het
Siglecg	T	C	7: 43,417,908	F633S	probably benign	Het
Skiv2l	A	G	17: 34,848,197	S89P	possibly damaging	Het
Slc22a13	T	C	9: 119,193,632	E501G	probably damaging	Het
Slc44a3	A	G	3: 121,510,206	S294P	probably damaging	Het
Smad3	T	G	9: 63,757,560	K40Q	probably damaging	Het
Soga1	T	A	2: 157,020,554	D1485V	probably damaging	Het
Stt3a	T	A	9: 36,749,712	M268L	probably benign	Het
Taf4	A	T	2: 179,924,494	V817E	probably damaging	Het
Tgfbr1	A	G	4: 47,383,835	T58A	probably benign	Het
Trpc6	T	C	9: 8,609,870	V113A	probably damaging	Het
Ttll13	T	A	7: 80,248,276		probably null	Het
Uba7	T	C	9: 107,980,165	L742P	probably benign	Het
Ulk2	A	G	11: 61,833,435	L174P	probably damaging	Het
Unc5c	A	T	3: 141,816,931	Y706F	probably benign	Het
Unc80	A	T	1: 66,649,672		probably null	Het
Usp34	T	A	11: 23,393,749		probably null	Het
Vmn1r71	A	T	7: 10,747,864	V233D	possibly damaging	Het
Xpo6	T	C	7: 126,140,583	K439R	probably benign	Het
Xrn1	G	T	9: 96,033,636	G1271C	probably damaging	Het
Yes1	A	T	5: 32,660,777	E386V	probably damaging	Het
Zfp759	C	A	13: 67,139,344	H320N	probably damaging	Het
Zfp990	A	T	4: 145,536,942	H170L	possibly damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73145635	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73113694	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73123148	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73119437	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73119378	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73111759	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73116137	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73118184	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73103894	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73134018	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73090622	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73118535	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73118121	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73130951	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73118505	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73118203	splice site	probably benign
IGL02859:Itgae	APN	11	73114867	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73125310	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73113601	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73115574	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73133854	splice site	probably null
IGL03352:Itgae	APN	11	73131730	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73130999	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73118147	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73123183	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73114907	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73138509	nonsense	probably null
R1231:Itgae	UTSW	11	73119379	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73125362	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73115592	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73145605	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73117162	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73118643	splice site	probably benign
R1915:Itgae	UTSW	11	73118643	splice site	probably benign
R2061:Itgae	UTSW	11	73118622	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73145569	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73121937	nonsense	probably null
R2680:Itgae	UTSW	11	73114926	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73140687	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73113616	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73111339	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73112134	missense	probably benign
R4212:Itgae	UTSW	11	73119352	missense	probably benign
R4213:Itgae	UTSW	11	73119352	missense	probably benign
R4691:Itgae	UTSW	11	73119519	nonsense	probably null
R5152:Itgae	UTSW	11	73130995	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73110556	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73145638	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73111849	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73133908	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73129248	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73145551	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73140757	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73145601	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73131693	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73111402	splice site	probably null
R6502:Itgae	UTSW	11	73145592	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73118496	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73119516	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73111369	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73111358	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73140678	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73121960	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73113631	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73123269	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73138792	missense	probably benign
R7860:Itgae	UTSW	11	73120273	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73134087	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73120384	missense	probably benign
R8911:Itgae	UTSW	11	73113621	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73125263	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73121926	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73116080	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73111803	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73125356	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73120345	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73111376	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1186:Itgae	UTSW	11	73115640	missense	probably benign
Z1186:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1187:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73115640	missense	probably benign
Z1187:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1188:Itgae	UTSW	11	73115640	missense	probably benign
Z1188:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73115640	missense	probably benign
Z1189:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1190:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73115640	missense	probably benign
Z1190:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	73115640	missense	probably benign
Z1191:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1192:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73115640	missense	probably benign
Z1192:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73134127	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- TGGGTACACATAAATGGGGC -3'
(R):5'- TTACCCAGTCTATACAGAGTCAGG -3'

Sequencing Primer
(F):5'- GCAGACATGGTGCTCTTACAATG -3'
(R):5'- CCAGTCTATACAGAGTCAGGTTTGC -3'

Posted On

2015-11-11