Incidental Mutation 'R4737:Hmcn1'
ID 359303
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms EG545370, LOC240793
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 150438275-150869186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 150565346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 2260 (K2260N)
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000074783
AA Change: K2260N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: K2260N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137197
AA Change: K2260N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: K2260N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,553,029 (GRCm39) missense probably benign
IGL00571:Hmcn1 APN 1 150,514,750 (GRCm39) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,682,117 (GRCm39) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,540,687 (GRCm39) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,532,485 (GRCm39) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,506,091 (GRCm39) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,486,464 (GRCm39) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,480,757 (GRCm39) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,458,052 (GRCm39) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,514,620 (GRCm39) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,502,784 (GRCm39) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,508,303 (GRCm39) splice site probably benign
IGL01304:Hmcn1 APN 1 150,498,675 (GRCm39) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,620,752 (GRCm39) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,594,991 (GRCm39) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,468,848 (GRCm39) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,734,990 (GRCm39) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,480,823 (GRCm39) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,485,382 (GRCm39) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,474,148 (GRCm39) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,503,164 (GRCm39) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,547,783 (GRCm39) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,455,984 (GRCm39) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,613,050 (GRCm39) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,459,031 (GRCm39) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,620,711 (GRCm39) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,547,789 (GRCm39) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,491,051 (GRCm39) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,566,352 (GRCm39) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,618,011 (GRCm39) splice site probably benign
IGL01906:Hmcn1 APN 1 150,543,638 (GRCm39) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,608,643 (GRCm39) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,479,622 (GRCm39) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,491,049 (GRCm39) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,579,932 (GRCm39) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,506,479 (GRCm39) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,598,358 (GRCm39) missense probably benign
IGL02155:Hmcn1 APN 1 150,439,349 (GRCm39) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,682,152 (GRCm39) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,540,666 (GRCm39) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,678,648 (GRCm39) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,598,175 (GRCm39) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,868,774 (GRCm39) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,685,477 (GRCm39) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,573,244 (GRCm39) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,620,746 (GRCm39) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,494,760 (GRCm39) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,480,654 (GRCm39) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,532,445 (GRCm39) nonsense probably null
IGL02735:Hmcn1 APN 1 150,522,583 (GRCm39) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,439,579 (GRCm39) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,551,725 (GRCm39) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,453,029 (GRCm39) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,532,958 (GRCm39) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,573,273 (GRCm39) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,547,668 (GRCm39) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,684,290 (GRCm39) missense probably benign
IGL03195:Hmcn1 APN 1 150,678,660 (GRCm39) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,619,418 (GRCm39) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,646,103 (GRCm39) splice site probably benign
IGL03268:Hmcn1 APN 1 150,648,261 (GRCm39) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,474,175 (GRCm39) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,505,982 (GRCm39) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,608,661 (GRCm39) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,577,720 (GRCm39) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,539,623 (GRCm39) missense probably damaging 1.00
Backbone UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
Cambrian UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
chordate UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
Justamere UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
Lancelet UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
notochord UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
wippoorwill UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,614,409 (GRCm39) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,596,440 (GRCm39) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,684,488 (GRCm39) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,545,238 (GRCm39) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,684,427 (GRCm39) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,528,302 (GRCm39) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,553,157 (GRCm39) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,462,766 (GRCm39) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,684,398 (GRCm39) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,553,075 (GRCm39) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,539,630 (GRCm39) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,479,562 (GRCm39) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,674,565 (GRCm39) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,591,573 (GRCm39) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,608,543 (GRCm39) splice site probably benign
R0503:Hmcn1 UTSW 1 150,735,003 (GRCm39) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,752,170 (GRCm39) splice site probably benign
R0506:Hmcn1 UTSW 1 150,618,092 (GRCm39) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,594,868 (GRCm39) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,525,768 (GRCm39) nonsense probably null
R0599:Hmcn1 UTSW 1 150,485,552 (GRCm39) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,533,127 (GRCm39) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,469,767 (GRCm39) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,674,470 (GRCm39) splice site probably null
R0699:Hmcn1 UTSW 1 150,695,161 (GRCm39) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,684,538 (GRCm39) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,629,416 (GRCm39) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,525,824 (GRCm39) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R0975:Hmcn1 UTSW 1 150,453,128 (GRCm39) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,494,679 (GRCm39) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1145:Hmcn1 UTSW 1 150,555,358 (GRCm39) splice site probably null
R1233:Hmcn1 UTSW 1 150,624,777 (GRCm39) missense probably benign
R1234:Hmcn1 UTSW 1 150,629,405 (GRCm39) nonsense probably null
R1291:Hmcn1 UTSW 1 150,623,942 (GRCm39) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,556,466 (GRCm39) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,522,545 (GRCm39) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,528,257 (GRCm39) splice site probably benign
R1458:Hmcn1 UTSW 1 150,485,451 (GRCm39) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,565,341 (GRCm39) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,648,303 (GRCm39) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,545,172 (GRCm39) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,649,554 (GRCm39) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,610,283 (GRCm39) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,532,992 (GRCm39) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,620,778 (GRCm39) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,545,309 (GRCm39) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,506,084 (GRCm39) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,441,120 (GRCm39) nonsense probably null
R1710:Hmcn1 UTSW 1 150,551,735 (GRCm39) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,734,937 (GRCm39) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,462,219 (GRCm39) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,474,781 (GRCm39) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,439,319 (GRCm39) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,624,834 (GRCm39) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,502,903 (GRCm39) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,474,036 (GRCm39) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,597,415 (GRCm39) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,532,944 (GRCm39) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,479,563 (GRCm39) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,596,446 (GRCm39) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,514,651 (GRCm39) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,453,046 (GRCm39) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,695,251 (GRCm39) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,533,202 (GRCm39) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,868,606 (GRCm39) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,480,633 (GRCm39) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,525,427 (GRCm39) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,553,127 (GRCm39) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,551,742 (GRCm39) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,614,364 (GRCm39) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,553,085 (GRCm39) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,453,074 (GRCm39) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,509,410 (GRCm39) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,591,566 (GRCm39) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,474,761 (GRCm39) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,500,349 (GRCm39) splice site probably benign
R2303:Hmcn1 UTSW 1 150,579,977 (GRCm39) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,528,429 (GRCm39) splice site probably benign
R2338:Hmcn1 UTSW 1 150,498,685 (GRCm39) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,441,135 (GRCm39) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,736,092 (GRCm39) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,474,783 (GRCm39) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,490,972 (GRCm39) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,562,618 (GRCm39) nonsense probably null
R2519:Hmcn1 UTSW 1 150,649,571 (GRCm39) nonsense probably null
R2520:Hmcn1 UTSW 1 150,619,398 (GRCm39) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,528,326 (GRCm39) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,506,403 (GRCm39) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2849:Hmcn1 UTSW 1 150,439,350 (GRCm39) nonsense probably null
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,614,467 (GRCm39) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,678,624 (GRCm39) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,624,786 (GRCm39) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,480,853 (GRCm39) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,565,269 (GRCm39) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,620,776 (GRCm39) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,678,575 (GRCm39) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,498,745 (GRCm39) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,462,169 (GRCm39) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,525,328 (GRCm39) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,462,716 (GRCm39) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,510,946 (GRCm39) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,566,361 (GRCm39) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,449,320 (GRCm39) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,598,204 (GRCm39) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,598,120 (GRCm39) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,648,253 (GRCm39) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,534,259 (GRCm39) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,471,750 (GRCm39) splice site probably null
R4441:Hmcn1 UTSW 1 150,533,210 (GRCm39) missense probably null
R4493:Hmcn1 UTSW 1 150,577,650 (GRCm39) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,509,417 (GRCm39) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,439,531 (GRCm39) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,610,238 (GRCm39) missense probably benign
R4601:Hmcn1 UTSW 1 150,614,396 (GRCm39) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,471,645 (GRCm39) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,551,262 (GRCm39) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,500,301 (GRCm39) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,494,816 (GRCm39) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,648,322 (GRCm39) splice site probably null
R4724:Hmcn1 UTSW 1 150,570,584 (GRCm39) splice site probably null
R4744:Hmcn1 UTSW 1 150,453,363 (GRCm39) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,629,362 (GRCm39) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,468,836 (GRCm39) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,553,130 (GRCm39) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,598,286 (GRCm39) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,752,111 (GRCm39) intron probably benign
R4968:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,695,200 (GRCm39) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,556,439 (GRCm39) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,464,008 (GRCm39) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,613,007 (GRCm39) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,486,420 (GRCm39) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,532,492 (GRCm39) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,522,452 (GRCm39) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,471,612 (GRCm39) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,555,265 (GRCm39) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,458,047 (GRCm39) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,631,123 (GRCm39) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,498,995 (GRCm39) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,577,723 (GRCm39) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,551,291 (GRCm39) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,485,576 (GRCm39) splice site probably null
R5531:Hmcn1 UTSW 1 150,619,539 (GRCm39) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,631,042 (GRCm39) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,613,257 (GRCm39) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,453,290 (GRCm39) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,532,318 (GRCm39) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,534,313 (GRCm39) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,485,529 (GRCm39) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,566,351 (GRCm39) nonsense probably null
R5718:Hmcn1 UTSW 1 150,485,417 (GRCm39) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,570,600 (GRCm39) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,634,225 (GRCm39) splice site probably null
R5739:Hmcn1 UTSW 1 150,684,448 (GRCm39) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,449,305 (GRCm39) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,570,629 (GRCm39) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,550,098 (GRCm39) nonsense probably null
R5809:Hmcn1 UTSW 1 150,525,358 (GRCm39) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,613,275 (GRCm39) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,868,774 (GRCm39) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,506,078 (GRCm39) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,474,648 (GRCm39) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,453,047 (GRCm39) nonsense probably null
R5940:Hmcn1 UTSW 1 150,532,973 (GRCm39) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,439,568 (GRCm39) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,579,924 (GRCm39) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,678,646 (GRCm39) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,508,188 (GRCm39) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,539,660 (GRCm39) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,646,081 (GRCm39) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,631,045 (GRCm39) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,631,044 (GRCm39) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,506,978 (GRCm39) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,494,687 (GRCm39) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,608,597 (GRCm39) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,598,175 (GRCm39) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,441,176 (GRCm39) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,522,535 (GRCm39) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6187:Hmcn1 UTSW 1 150,506,479 (GRCm39) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,614,432 (GRCm39) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,573,170 (GRCm39) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,573,227 (GRCm39) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,620,711 (GRCm39) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,578,967 (GRCm39) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,868,670 (GRCm39) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,540,535 (GRCm39) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,553,053 (GRCm39) nonsense probably null
R6490:Hmcn1 UTSW 1 150,459,029 (GRCm39) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,573,317 (GRCm39) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,491,189 (GRCm39) splice site probably null
R6612:Hmcn1 UTSW 1 150,470,869 (GRCm39) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,599,008 (GRCm39) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,619,547 (GRCm39) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,634,057 (GRCm39) missense probably benign
R6687:Hmcn1 UTSW 1 150,620,784 (GRCm39) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,579,926 (GRCm39) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,610,269 (GRCm39) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,646,044 (GRCm39) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,868,802 (GRCm39) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,475,404 (GRCm39) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,649,641 (GRCm39) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,479,853 (GRCm39) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,736,118 (GRCm39) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,479,997 (GRCm39) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,576,292 (GRCm39) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,452,961 (GRCm39) splice site probably null
R7144:Hmcn1 UTSW 1 150,539,624 (GRCm39) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,562,605 (GRCm39) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,624,744 (GRCm39) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,629,450 (GRCm39) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,525,331 (GRCm39) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,514,627 (GRCm39) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,598,394 (GRCm39) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,591,574 (GRCm39) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,458,088 (GRCm39) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,559,466 (GRCm39) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,608,880 (GRCm39) splice site probably null
R7316:Hmcn1 UTSW 1 150,608,697 (GRCm39) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,479,565 (GRCm39) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,514,617 (GRCm39) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,559,496 (GRCm39) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,543,640 (GRCm39) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,682,196 (GRCm39) nonsense probably null
R7360:Hmcn1 UTSW 1 150,494,597 (GRCm39) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,439,382 (GRCm39) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,522,421 (GRCm39) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,550,181 (GRCm39) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,596,510 (GRCm39) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,506,017 (GRCm39) nonsense probably null
R7454:Hmcn1 UTSW 1 150,439,355 (GRCm39) missense probably damaging 1.00
R7476:Hmcn1 UTSW 1 150,456,018 (GRCm39) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,552,985 (GRCm39) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,498,718 (GRCm39) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,532,324 (GRCm39) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,562,531 (GRCm39) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,480,625 (GRCm39) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,531,586 (GRCm39) missense probably benign
R7588:Hmcn1 UTSW 1 150,532,885 (GRCm39) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,441,080 (GRCm39) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,522,460 (GRCm39) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,543,631 (GRCm39) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,598,196 (GRCm39) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,632,343 (GRCm39) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,646,030 (GRCm39) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,682,172 (GRCm39) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,620,722 (GRCm39) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,533,221 (GRCm39) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,468,940 (GRCm39) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,540,643 (GRCm39) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,485,526 (GRCm39) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,525,835 (GRCm39) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,531,606 (GRCm39) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,540,629 (GRCm39) nonsense probably null
R8015:Hmcn1 UTSW 1 150,474,062 (GRCm39) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,525,743 (GRCm39) nonsense probably null
R8072:Hmcn1 UTSW 1 150,532,256 (GRCm39) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,624,841 (GRCm39) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,734,957 (GRCm39) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,629,411 (GRCm39) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,480,705 (GRCm39) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,522,409 (GRCm39) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,598,265 (GRCm39) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,453,228 (GRCm39) nonsense probably null
R8234:Hmcn1 UTSW 1 150,469,761 (GRCm39) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,695,117 (GRCm39) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,735,005 (GRCm39) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,614,515 (GRCm39) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,614,485 (GRCm39) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,634,142 (GRCm39) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,570,671 (GRCm39) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,479,551 (GRCm39) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,455,990 (GRCm39) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,449,302 (GRCm39) nonsense probably null
R8559:Hmcn1 UTSW 1 150,551,789 (GRCm39) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,631,008 (GRCm39) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,509,371 (GRCm39) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,556,413 (GRCm39) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,540,636 (GRCm39) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,591,469 (GRCm39) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,610,248 (GRCm39) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,531,570 (GRCm39) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,547,726 (GRCm39) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,514,659 (GRCm39) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,525,723 (GRCm39) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,649,530 (GRCm39) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,630,795 (GRCm39) intron probably benign
R9030:Hmcn1 UTSW 1 150,692,870 (GRCm39) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,565,320 (GRCm39) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,532,869 (GRCm39) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,573,331 (GRCm39) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,474,141 (GRCm39) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,506,092 (GRCm39) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,488,405 (GRCm39) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,500,337 (GRCm39) nonsense probably null
R9204:Hmcn1 UTSW 1 150,610,262 (GRCm39) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,594,844 (GRCm39) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,473,740 (GRCm39) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,632,309 (GRCm39) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,506,046 (GRCm39) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,522,343 (GRCm39) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,545,187 (GRCm39) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,506,053 (GRCm39) nonsense probably null
R9464:Hmcn1 UTSW 1 150,599,248 (GRCm39) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,506,471 (GRCm39) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,610,281 (GRCm39) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,579,971 (GRCm39) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,470,990 (GRCm39) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,462,127 (GRCm39) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,545,175 (GRCm39) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,498,660 (GRCm39) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,475,303 (GRCm39) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,555,346 (GRCm39) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,684,473 (GRCm39) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,506,054 (GRCm39) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,619,492 (GRCm39) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,613,356 (GRCm39) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,485,378 (GRCm39) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,674,566 (GRCm39) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,623,941 (GRCm39) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,632,339 (GRCm39) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,868,625 (GRCm39) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,598,380 (GRCm39) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,528,333 (GRCm39) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,608,689 (GRCm39) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,684,391 (GRCm39) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,500,312 (GRCm39) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,510,897 (GRCm39) nonsense probably null
X0022:Hmcn1 UTSW 1 150,576,281 (GRCm39) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,736,127 (GRCm39) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,539,652 (GRCm39) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,524,688 (GRCm39) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,539,668 (GRCm39) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,531,672 (GRCm39) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,462,196 (GRCm39) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- CGTGAATGGCTCTTACAACTCTAGAG -3'
(R):5'- GGCTTAAAGTCTGTAGTTGAGC -3'

Sequencing Primer
(F):5'- GGTGGAGGAGATCAGTAACT -3'
(R):5'- AAGTCTGTAGTTGAGCAGATTTTC -3'
Posted On 2015-11-11