Incidental Mutation 'R4737:Tnn'
ID 359305
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms tenascin-W, Tnw
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 159912599-159981150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 159973659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 236 (D236A)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect possibly damaging
Transcript: ENSMUST00000039178
AA Change: D236A

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: D236A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: D236A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: D236A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.2590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 159,953,021 (GRCm39) missense possibly damaging 0.65
IGL00433:Tnn APN 1 159,925,776 (GRCm39) splice site probably benign
IGL00858:Tnn APN 1 159,915,962 (GRCm39) critical splice donor site probably null
IGL00939:Tnn APN 1 159,975,100 (GRCm39) missense probably damaging 1.00
IGL01569:Tnn APN 1 159,948,124 (GRCm39) missense possibly damaging 0.51
IGL01591:Tnn APN 1 159,953,144 (GRCm39) missense probably damaging 1.00
IGL01628:Tnn APN 1 159,975,172 (GRCm39) missense possibly damaging 0.89
IGL01811:Tnn APN 1 159,934,705 (GRCm39) missense probably damaging 1.00
IGL01813:Tnn APN 1 159,916,008 (GRCm39) missense probably damaging 1.00
IGL02340:Tnn APN 1 159,972,775 (GRCm39) missense probably benign 0.00
IGL02488:Tnn APN 1 159,968,163 (GRCm39) missense probably benign 0.21
IGL02535:Tnn APN 1 159,950,222 (GRCm39) splice site probably null
IGL02563:Tnn APN 1 159,942,123 (GRCm39) missense probably damaging 1.00
IGL02572:Tnn APN 1 159,913,677 (GRCm39) missense probably damaging 1.00
IGL02740:Tnn APN 1 159,968,347 (GRCm39) splice site probably benign
IGL02818:Tnn APN 1 159,943,848 (GRCm39) missense possibly damaging 0.86
IGL03284:Tnn APN 1 159,953,022 (GRCm39) missense probably benign 0.01
1mM(1):Tnn UTSW 1 159,924,911 (GRCm39) missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 159,913,647 (GRCm39) missense possibly damaging 0.91
R0023:Tnn UTSW 1 159,932,498 (GRCm39) missense probably benign 0.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0234:Tnn UTSW 1 159,916,036 (GRCm39) missense probably damaging 1.00
R0316:Tnn UTSW 1 159,948,137 (GRCm39) missense possibly damaging 0.93
R0492:Tnn UTSW 1 159,948,327 (GRCm39) missense probably damaging 0.99
R0547:Tnn UTSW 1 159,943,907 (GRCm39) intron probably benign
R1067:Tnn UTSW 1 159,952,968 (GRCm39) missense probably damaging 1.00
R1563:Tnn UTSW 1 159,952,985 (GRCm39) missense probably damaging 1.00
R1565:Tnn UTSW 1 159,924,835 (GRCm39) missense probably damaging 1.00
R1615:Tnn UTSW 1 159,945,978 (GRCm39) missense possibly damaging 0.93
R1637:Tnn UTSW 1 159,975,170 (GRCm39) missense probably damaging 1.00
R1707:Tnn UTSW 1 159,972,714 (GRCm39) missense probably damaging 1.00
R1758:Tnn UTSW 1 159,975,154 (GRCm39) missense possibly damaging 0.61
R1797:Tnn UTSW 1 159,968,258 (GRCm39) missense probably damaging 1.00
R1847:Tnn UTSW 1 159,943,752 (GRCm39) missense possibly damaging 0.51
R1925:Tnn UTSW 1 159,924,799 (GRCm39) missense probably damaging 1.00
R2182:Tnn UTSW 1 159,968,170 (GRCm39) splice site probably null
R2196:Tnn UTSW 1 159,924,798 (GRCm39) nonsense probably null
R2225:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2227:Tnn UTSW 1 159,975,035 (GRCm39) missense probably damaging 1.00
R2286:Tnn UTSW 1 159,938,079 (GRCm39) missense possibly damaging 0.89
R2850:Tnn UTSW 1 159,966,857 (GRCm39) missense probably benign 0.00
R3110:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3111:Tnn UTSW 1 159,934,625 (GRCm39) missense probably damaging 0.98
R3112:Tnn UTSW 1 159,943,856 (GRCm39) missense possibly damaging 0.71
R3729:Tnn UTSW 1 159,973,810 (GRCm39) missense probably damaging 1.00
R4183:Tnn UTSW 1 159,924,925 (GRCm39) missense probably damaging 1.00
R4439:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4441:Tnn UTSW 1 159,943,650 (GRCm39) missense probably benign
R4588:Tnn UTSW 1 159,972,681 (GRCm39) missense probably benign 0.25
R4646:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4647:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4648:Tnn UTSW 1 159,973,612 (GRCm39) missense probably benign
R4701:Tnn UTSW 1 159,975,338 (GRCm39) missense possibly damaging 0.72
R4703:Tnn UTSW 1 159,943,815 (GRCm39) missense possibly damaging 0.84
R4801:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4802:Tnn UTSW 1 159,972,603 (GRCm39) missense possibly damaging 0.90
R4868:Tnn UTSW 1 159,958,443 (GRCm39) missense possibly damaging 0.64
R4977:Tnn UTSW 1 159,948,188 (GRCm39) missense probably damaging 1.00
R5011:Tnn UTSW 1 159,953,949 (GRCm39) missense possibly damaging 0.89
R5026:Tnn UTSW 1 159,973,707 (GRCm39) missense probably benign 0.00
R5027:Tnn UTSW 1 159,972,781 (GRCm39) missense probably damaging 1.00
R5049:Tnn UTSW 1 159,968,308 (GRCm39) missense probably benign 0.00
R5119:Tnn UTSW 1 159,948,122 (GRCm39) missense probably damaging 0.98
R5128:Tnn UTSW 1 159,950,464 (GRCm39) missense probably damaging 0.98
R5234:Tnn UTSW 1 159,972,569 (GRCm39) missense possibly damaging 0.95
R5398:Tnn UTSW 1 159,975,092 (GRCm39) missense probably benign 0.00
R5424:Tnn UTSW 1 159,950,272 (GRCm39) missense possibly damaging 0.69
R5452:Tnn UTSW 1 159,937,831 (GRCm39) missense probably benign 0.13
R5466:Tnn UTSW 1 159,948,106 (GRCm39) missense possibly damaging 0.93
R6022:Tnn UTSW 1 159,937,928 (GRCm39) missense probably benign 0.00
R6062:Tnn UTSW 1 159,925,848 (GRCm39) missense probably damaging 1.00
R6086:Tnn UTSW 1 159,913,690 (GRCm39) missense probably damaging 1.00
R6132:Tnn UTSW 1 159,973,641 (GRCm39) missense probably damaging 0.96
R6324:Tnn UTSW 1 159,972,774 (GRCm39) missense probably damaging 0.96
R6455:Tnn UTSW 1 159,942,289 (GRCm39) missense probably damaging 1.00
R6563:Tnn UTSW 1 159,915,968 (GRCm39) missense probably damaging 1.00
R6650:Tnn UTSW 1 159,942,153 (GRCm39) missense probably damaging 1.00
R6806:Tnn UTSW 1 159,948,278 (GRCm39) missense possibly damaging 0.95
R6810:Tnn UTSW 1 159,932,412 (GRCm39) missense probably damaging 1.00
R7157:Tnn UTSW 1 159,953,947 (GRCm39) nonsense probably null
R7243:Tnn UTSW 1 159,934,687 (GRCm39) missense probably benign 0.07
R7340:Tnn UTSW 1 159,973,592 (GRCm39) missense probably damaging 0.98
R7472:Tnn UTSW 1 159,937,917 (GRCm39) missense probably benign 0.12
R7502:Tnn UTSW 1 159,937,929 (GRCm39) missense probably benign 0.00
R7527:Tnn UTSW 1 159,946,074 (GRCm39) missense possibly damaging 0.51
R7608:Tnn UTSW 1 159,915,984 (GRCm39) nonsense probably null
R7746:Tnn UTSW 1 159,942,255 (GRCm39) missense probably damaging 0.97
R8096:Tnn UTSW 1 159,950,411 (GRCm39) missense probably damaging 1.00
R8136:Tnn UTSW 1 159,934,630 (GRCm39) missense probably damaging 0.96
R8191:Tnn UTSW 1 159,953,088 (GRCm39) missense probably damaging 1.00
R8334:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8335:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8337:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8338:Tnn UTSW 1 159,946,053 (GRCm39) missense probably damaging 1.00
R8427:Tnn UTSW 1 159,958,256 (GRCm39) missense probably damaging 0.99
R8433:Tnn UTSW 1 159,924,790 (GRCm39) missense possibly damaging 0.81
R8479:Tnn UTSW 1 159,950,397 (GRCm39) missense probably benign 0.06
R8505:Tnn UTSW 1 159,973,593 (GRCm39) missense probably damaging 0.98
R8554:Tnn UTSW 1 159,937,986 (GRCm39) missense probably damaging 1.00
R8717:Tnn UTSW 1 159,943,846 (GRCm39) missense possibly damaging 0.51
R8850:Tnn UTSW 1 159,937,814 (GRCm39) critical splice donor site probably null
R8928:Tnn UTSW 1 159,953,099 (GRCm39) missense probably damaging 1.00
R9209:Tnn UTSW 1 159,953,986 (GRCm39) missense probably benign 0.02
X0019:Tnn UTSW 1 159,913,716 (GRCm39) missense probably damaging 1.00
Z1176:Tnn UTSW 1 159,973,863 (GRCm39) missense probably benign
Z1177:Tnn UTSW 1 159,954,097 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTCCAAGTAAGGCAACCTG -3'
(R):5'- CTTTTCCTGGCAGATCTGAGC -3'

Sequencing Primer
(F):5'- TCTCCAAGTAAGGCAACCTGTAATAG -3'
(R):5'- AGACTGTGATCAGCCCACCTG -3'
Posted On 2015-11-11