Incidental Mutation 'R4737:Acp2'
ID 359312
Institutional Source Beutler Lab
Gene Symbol Acp2
Ensembl Gene ENSMUSG00000002103
Gene Name acid phosphatase 2, lysosomal
Synonyms Acp-2, LAP
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 91033230-91044443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91041068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 419 (R419W)
Ref Sequence ENSEMBL: ENSMUSP00000002172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002172] [ENSMUST00000028696] [ENSMUST00000111352] [ENSMUST00000150403] [ENSMUST00000155418]
AlphaFold P24638
Predicted Effect probably benign
Transcript: ENSMUST00000002172
AA Change: R419W

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002172
Gene: ENSMUSG00000002103
AA Change: R419W

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 54 330 1.5e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028696
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111352
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135927
Predicted Effect probably benign
Transcript: ENSMUST00000150403
SMART Domains Protein: ENSMUSP00000119144
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 159 4e-35 PFAM
Pfam:His_Phos_2 147 297 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152277
Predicted Effect probably benign
Transcript: ENSMUST00000155418
SMART Domains Protein: ENSMUSP00000116030
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 166 4e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of lysosomal acid phosphatase (LAP). LAP is chemically and genetically distinct from red cell acid phosphatase. The encoded protein belongs to a family of distinct isoenzymes which hydrolyze orthophosphoric monoesters to alcohol and phosphate. LAP-deficiencies in mice cause multiple defects including bone structure alterations, lysosomal storage defects in the kidneys and central nervous system, and an increased tendency towards seizures. An enzymatically-inactive allele of LAP in mice exhibited a more severe phenotype than the null allele, and defects included cerebellum abnormalities, growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene result in skeletal defects and a small percentage of mutant animals exhibit tonic-clonic seizures. Mice with a missense mutation (Gly244Glu) are growth retarded and exhibit a disrupted cerebellum cytoarchitecture, an abnormal hair shaft, and skin malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Acp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Acp2 APN 2 91,034,028 (GRCm39) missense probably damaging 1.00
IGL02251:Acp2 APN 2 91,038,678 (GRCm39) splice site probably null
IGL02445:Acp2 APN 2 91,036,606 (GRCm39) missense possibly damaging 0.63
IGL02952:Acp2 APN 2 91,038,788 (GRCm39) unclassified probably benign
IGL03272:Acp2 APN 2 91,034,578 (GRCm39) splice site probably benign
BB008:Acp2 UTSW 2 91,037,060 (GRCm39) critical splice acceptor site probably null
BB018:Acp2 UTSW 2 91,037,060 (GRCm39) critical splice acceptor site probably null
R0781:Acp2 UTSW 2 91,038,767 (GRCm39) splice site probably null
R1110:Acp2 UTSW 2 91,038,767 (GRCm39) splice site probably null
R2107:Acp2 UTSW 2 91,033,940 (GRCm39) splice site probably benign
R4382:Acp2 UTSW 2 91,038,454 (GRCm39) missense possibly damaging 0.80
R4726:Acp2 UTSW 2 91,034,622 (GRCm39) missense probably damaging 1.00
R4793:Acp2 UTSW 2 91,037,134 (GRCm39) missense probably benign 0.13
R4817:Acp2 UTSW 2 91,033,963 (GRCm39) missense probably damaging 1.00
R5089:Acp2 UTSW 2 91,042,267 (GRCm39) unclassified probably benign
R5092:Acp2 UTSW 2 91,038,391 (GRCm39) missense probably benign 0.19
R5468:Acp2 UTSW 2 91,036,443 (GRCm39) missense probably benign
R7847:Acp2 UTSW 2 91,041,077 (GRCm39) missense possibly damaging 0.67
R7931:Acp2 UTSW 2 91,037,060 (GRCm39) critical splice acceptor site probably null
R8735:Acp2 UTSW 2 91,034,651 (GRCm39) missense probably benign 0.00
R8877:Acp2 UTSW 2 91,036,129 (GRCm39) missense probably damaging 1.00
R9375:Acp2 UTSW 2 91,037,174 (GRCm39) missense probably benign 0.01
R9435:Acp2 UTSW 2 91,036,409 (GRCm39) missense probably damaging 1.00
R9438:Acp2 UTSW 2 91,033,339 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGTTCTCCTATCAGATGTG -3'
(R):5'- ATGAAGATGGTGAGCCCCAG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GGTGAGCCCCAGGTGCC -3'
Posted On 2015-11-11