Incidental Mutation 'R4737:Srsf11'
ID 359323
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Name serine/arginine-rich splicing factor 11
Synonyms 0610009J05Rik, Sfrs11, 2610019N13Rik
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 158010473-158036639 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 158026732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 82 (Y82*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
AlphaFold E9Q6E5
Predicted Effect probably null
Transcript: ENSMUST00000069025
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: Y120*

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072875
AA Change: Y103*
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: Y103*

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000089922
Predicted Effect probably null
Transcript: ENSMUST00000121326
AA Change: Y138*
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: Y138*

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126716
AA Change: Y103*
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436
AA Change: Y103*

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133090
Predicted Effect probably null
Transcript: ENSMUST00000137444
AA Change: Y103*
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436
AA Change: Y103*

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140491
AA Change: Y43*
SMART Domains Protein: ENSMUSP00000118767
Gene: ENSMUSG00000055436
AA Change: Y43*

DomainStartEndE-ValueType
Blast:RRM 2 42 1e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000147304
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000115487
Gene: ENSMUSG00000055436
AA Change: Y82*

DomainStartEndE-ValueType
RRM 7 81 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199742
Predicted Effect probably benign
Transcript: ENSMUST00000198705
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 158012035 unclassified probably benign
IGL01600:Srsf11 APN 3 158019442 splice site probably benign
IGL02724:Srsf11 APN 3 158016431 unclassified probably benign
IGL03147:Srsf11 UTSW 3 158026740 missense probably damaging 1.00
R0195:Srsf11 UTSW 3 158036535 unclassified probably benign
R0578:Srsf11 UTSW 3 158012067 unclassified probably benign
R0580:Srsf11 UTSW 3 158012067 unclassified probably benign
R1075:Srsf11 UTSW 3 158012790 intron probably benign
R1604:Srsf11 UTSW 3 158019311 critical splice donor site probably null
R1797:Srsf11 UTSW 3 158019428 missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 158016427 unclassified probably benign
R1899:Srsf11 UTSW 3 158031580 unclassified probably benign
R2105:Srsf11 UTSW 3 158019345 missense probably damaging 0.99
R4605:Srsf11 UTSW 3 158022923 nonsense probably null
R4655:Srsf11 UTSW 3 158023335 missense probably benign 0.15
R5244:Srsf11 UTSW 3 158023344 unclassified probably benign
R5245:Srsf11 UTSW 3 158023344 unclassified probably benign
R5379:Srsf11 UTSW 3 158023344 unclassified probably benign
R5401:Srsf11 UTSW 3 158023344 unclassified probably benign
R5625:Srsf11 UTSW 3 158023344 unclassified probably benign
R5763:Srsf11 UTSW 3 158023344 unclassified probably benign
R5814:Srsf11 UTSW 3 158023344 unclassified probably benign
R5938:Srsf11 UTSW 3 158023344 unclassified probably benign
R5944:Srsf11 UTSW 3 158023344 unclassified probably benign
R5945:Srsf11 UTSW 3 158023344 unclassified probably benign
R6126:Srsf11 UTSW 3 158023344 unclassified probably benign
R6175:Srsf11 UTSW 3 158023344 unclassified probably benign
R6427:Srsf11 UTSW 3 158023344 unclassified probably benign
R6435:Srsf11 UTSW 3 158023344 unclassified probably benign
R6436:Srsf11 UTSW 3 158023344 unclassified probably benign
R6614:Srsf11 UTSW 3 158023344 unclassified probably benign
R6616:Srsf11 UTSW 3 158023344 unclassified probably benign
R7615:Srsf11 UTSW 3 158016425 missense unknown
R8787:Srsf11 UTSW 3 158012400 missense unknown
R9352:Srsf11 UTSW 3 158012199 missense unknown
R9547:Srsf11 UTSW 3 158012098 missense unknown
X0017:Srsf11 UTSW 3 158016349 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTGAGGATGATATGAATGTTTACC -3'
(R):5'- TTTACCAGAGCATTGTCCTTTTGG -3'

Sequencing Primer
(F):5'- ATGAATGTTTACCTTTGGGACTTC -3'
(R):5'- CCAGAGCATTGTCCTTTTGGTGATG -3'
Posted On 2015-11-11