Incidental Mutation 'R4737:Lck'
ID359326
Institutional Source Beutler Lab
Gene Symbol Lck
Ensembl Gene ENSMUSG00000000409
Gene Namelymphocyte protein tyrosine kinase
SynonymsHck-3, p56
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129548344-129573641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129555984 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 229 (T229I)
Ref Sequence ENSEMBL: ENSMUSP00000125777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067240] [ENSMUST00000102596] [ENSMUST00000134336] [ENSMUST00000167288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067240
AA Change: T218I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066209
Gene: ENSMUSG00000000409
AA Change: T218I

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102596
AA Change: T218I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099656
Gene: ENSMUSG00000000409
AA Change: T218I

DomainStartEndE-ValueType
SH3 64 120 3.53e-17 SMART
SH2 125 215 2.07e-34 SMART
TyrKc 245 494 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132030
Predicted Effect probably benign
Transcript: ENSMUST00000134336
SMART Domains Protein: ENSMUSP00000119263
Gene: ENSMUSG00000000409

DomainStartEndE-ValueType
PDB:1Q69|B 7 33 9e-12 PDB
SCOP:d1awj__ 45 92 2e-8 SMART
PDB:1LCK|A 53 92 3e-20 PDB
Blast:SH3 64 92 4e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139957
Predicted Effect possibly damaging
Transcript: ENSMUST00000167288
AA Change: T229I

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: T229I

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183371
Meta Mutation Damage Score 0.2588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Lck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.00
IGL02666:Lck APN 4 129556419 missense probably damaging 0.98
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
stromberg UTSW 4 129555640 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.88
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1013:Lck UTSW 4 129558127 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense probably damaging 0.98
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R5706:Lck UTSW 4 129551638 critical splice acceptor site probably null
R5712:Lck UTSW 4 129556310 missense probably benign
R7023:Lck UTSW 4 129548865 missense possibly damaging 0.89
R7411:Lck UTSW 4 129551970 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGAATAGGCCAGTGTGAG -3'
(R):5'- TTCCCCTTCAGTGGATGAGG -3'

Sequencing Primer
(F):5'- TGAGAGGAAGCTCACATTCTCTC -3'
(R):5'- GTATAGAACCTGACCCTAGACCCTG -3'
Posted On2015-11-11