Incidental Mutation 'R4737:Cftr'
ID359334
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Namecystic fibrosis transmembrane conductance regulator
SynonymsAbcc7
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18170687-18322768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18299883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1218 (D1218E)
Ref Sequence ENSEMBL: ENSMUSP00000049228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]
PDB Structure
mouse CFTR NBD1 with AMP.PNP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) apo [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ADP [X-RAY DIFFRACTION]
Phosphorylated Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP [X-RAY DIFFRACTION]
Cystic fibrosis transmembrane conductance regulator (CFTR) nucleotide-binding domain one (NBD1) with ATP, I4122 space group [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508S mutant [X-RAY DIFFRACTION]
Structure of NBD1 from murine CFTR- F508R mutant [X-RAY DIFFRACTION]
The crystal structure of the NBD1 domain of the mouse CFTR protein, deltaF508 mutant [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000045706
AA Change: D1218E

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: D1218E

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115406
AA Change: D1188E

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: D1188E

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120840
Predicted Effect probably benign
Transcript: ENSMUST00000140407
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18268430 critical splice donor site probably null
IGL01082:Cftr APN 6 18226103 missense probably damaging 0.97
IGL01113:Cftr APN 6 18270253 missense probably damaging 1.00
IGL01383:Cftr APN 6 18226041 missense probably benign 0.00
IGL01595:Cftr APN 6 18198239 splice site probably benign
IGL01820:Cftr APN 6 18226139 missense probably damaging 1.00
IGL02223:Cftr APN 6 18221482 missense probably damaging 1.00
IGL02249:Cftr APN 6 18277871 missense possibly damaging 0.58
IGL02439:Cftr APN 6 18258238 nonsense probably null
IGL02537:Cftr APN 6 18274597 missense probably benign 0.31
IGL03234:Cftr APN 6 18225988 missense probably damaging 0.96
PIT4453001:Cftr UTSW 6 18214106 missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18277843 missense probably benign 0.01
R0114:Cftr UTSW 6 18282448 missense probably damaging 1.00
R0329:Cftr UTSW 6 18226097 missense probably null 1.00
R0330:Cftr UTSW 6 18226097 missense probably null 1.00
R0331:Cftr UTSW 6 18235226 missense possibly damaging 0.72
R0480:Cftr UTSW 6 18274518 splice site probably benign
R0612:Cftr UTSW 6 18198126 missense probably benign 0.01
R0633:Cftr UTSW 6 18305980 missense probably damaging 0.99
R0830:Cftr UTSW 6 18270225 missense probably benign 0.02
R1559:Cftr UTSW 6 18225937 missense probably benign 0.01
R1629:Cftr UTSW 6 18226106 missense probably damaging 1.00
R1636:Cftr UTSW 6 18226157 missense probably damaging 0.99
R1860:Cftr UTSW 6 18268289 missense probably benign 0.00
R2043:Cftr UTSW 6 18320935 missense probably benign
R2211:Cftr UTSW 6 18214280 missense probably null 0.13
R4793:Cftr UTSW 6 18226088 missense probably damaging 1.00
R4857:Cftr UTSW 6 18320975 missense possibly damaging 0.92
R4984:Cftr UTSW 6 18235199 missense possibly damaging 0.89
R4999:Cftr UTSW 6 18221614 missense probably benign 0.17
R5045:Cftr UTSW 6 18230081 missense probably benign 0.20
R5183:Cftr UTSW 6 18299833 missense probably damaging 0.99
R5197:Cftr UTSW 6 18255414 missense probably benign 0.00
R5288:Cftr UTSW 6 18226129 nonsense probably null
R5337:Cftr UTSW 6 18319059 missense probably damaging 1.00
R5549:Cftr UTSW 6 18227954 missense probably benign 0.00
R5596:Cftr UTSW 6 18268096 missense probably benign 0.00
R5651:Cftr UTSW 6 18255365 splice site probably null
R5660:Cftr UTSW 6 18313687 missense probably benign 0.22
R5941:Cftr UTSW 6 18313646 missense probably damaging 1.00
R6221:Cftr UTSW 6 18282501 missense probably benign 0.00
R6222:Cftr UTSW 6 18282501 missense probably benign 0.00
R6229:Cftr UTSW 6 18220684 missense probably damaging 1.00
R6256:Cftr UTSW 6 18274661 missense probably damaging 0.96
R6257:Cftr UTSW 6 18282501 missense probably benign 0.00
R6412:Cftr UTSW 6 18285604 missense probably damaging 0.97
R6459:Cftr UTSW 6 18258236 missense probably damaging 1.00
R6558:Cftr UTSW 6 18222528 missense probably damaging 1.00
R6724:Cftr UTSW 6 18255974 nonsense probably null
R6787:Cftr UTSW 6 18274608 nonsense probably null
R6861:Cftr UTSW 6 18268108 missense probably benign 0.00
R6888:Cftr UTSW 6 18313730 critical splice donor site probably null
R7084:Cftr UTSW 6 18226138 missense probably benign 0.17
R7105:Cftr UTSW 6 18318972 missense probably damaging 1.00
R7320:Cftr UTSW 6 18319013 missense probably damaging 0.97
R7359:Cftr UTSW 6 18221624 missense probably benign 0.00
R7466:Cftr UTSW 6 18227973 missense probably benign
R7502:Cftr UTSW 6 18214296 missense probably damaging 1.00
R7748:Cftr UTSW 6 18277889 critical splice donor site probably null
R7808:Cftr UTSW 6 18204205 missense probably benign
R7817:Cftr UTSW 6 18267968 missense probably damaging 0.97
R7995:Cftr UTSW 6 18214156 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCCACTGTCTAGAGTTTTC -3'
(R):5'- GTCACACCTTCAACTATGTATAAGGG -3'

Sequencing Primer
(F):5'- CCACTGTCTAGAGTTTTCAAACAAAC -3'
(R):5'- GTTGGGACCCACTAACAAA -3'
Posted On2015-11-11