Incidental Mutation 'R4737:Olfr584'
ID359344
Institutional Source Beutler Lab
Gene Symbol Olfr584
Ensembl Gene ENSMUSG00000073959
Gene Nameolfactory receptor 584
SynonymsGA_x6K02T2PBJ9-5796876-5797820, MOR30-2
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103081885-103088315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103085914 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 127 (A127V)
Ref Sequence ENSEMBL: ENSMUSP00000151043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098210] [ENSMUST00000211036] [ENSMUST00000214215]
Predicted Effect probably damaging
Transcript: ENSMUST00000098210
AA Change: A132V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095811
Gene: ENSMUSG00000073959
AA Change: A132V

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 1.4e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 234 2.1e-9 PFAM
Pfam:7tm_1 48 299 4.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211036
AA Change: A127V
Predicted Effect probably damaging
Transcript: ENSMUST00000214215
AA Change: A127V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Olfr584
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Olfr584 APN 7 103086375 missense probably benign 0.00
IGL02113:Olfr584 APN 7 103085850 missense possibly damaging 0.95
IGL02398:Olfr584 APN 7 103086106 missense probably damaging 1.00
IGL02718:Olfr584 APN 7 103085583 missense probably benign 0.01
IGL02941:Olfr584 APN 7 103086321 missense probably benign 0.05
IGL02942:Olfr584 APN 7 103086198 missense probably benign 0.07
R0496:Olfr584 UTSW 7 103085590 missense probably damaging 1.00
R0511:Olfr584 UTSW 7 103085851 missense probably damaging 1.00
R0646:Olfr584 UTSW 7 103086151 missense probably damaging 0.99
R1652:Olfr584 UTSW 7 103085806 missense probably benign 0.04
R2312:Olfr584 UTSW 7 103086426 missense probably damaging 0.99
R2849:Olfr584 UTSW 7 103086112 missense probably damaging 1.00
R2937:Olfr584 UTSW 7 103086341 missense probably benign 0.01
R3176:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3276:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3708:Olfr584 UTSW 7 103086294 missense probably damaging 1.00
R5045:Olfr584 UTSW 7 103086457 missense probably benign 0.00
R5172:Olfr584 UTSW 7 103085677 missense probably damaging 1.00
R5849:Olfr584 UTSW 7 103085521 start codon destroyed probably null 0.02
R6294:Olfr584 UTSW 7 103085667 missense probably benign 0.01
R6846:Olfr584 UTSW 7 103086058 missense possibly damaging 0.88
R6869:Olfr584 UTSW 7 103085868 missense possibly damaging 0.47
R6936:Olfr584 UTSW 7 103085814 missense probably damaging 0.97
R7133:Olfr584 UTSW 7 103085998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTACCACTGACCTTGTC -3'
(R):5'- TCCATATCCACGATTGACTCTGG -3'

Sequencing Primer
(F):5'- GCTACCACTGACCTTGTCCTGTC -3'
(R):5'- ACGATTGACTCTGGTATCAGCAC -3'
Posted On2015-11-11