Mutagenetix > Incidental Mutation

Incidental Mutation 'R4737:Muc6'

359347

Institutional Source

Beutler Lab

Gene Symbol

Muc6

Ensembl Gene

ENSMUSG00000048191

Gene Name

mucin 6, gastric

Synonyms

MMRRC Submission

042024-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R4737 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141213373-141241641 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

T to G at 141226426 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000062451
AA Change: T1534P

SMART Domains

Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: T1534P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	2.49e-14	SMART
C8	267	340	5.46e-3	SMART
Pfam:TIL	344	399	5.6e-14	PFAM
VWC	401	469	2.57e-7	SMART
VWD	428	591	4.81e-30	SMART
C8	627	703	8.84e-21	SMART
SCOP:d1coua_	706	769	7e-9	SMART
Pfam:TIL	806	869	1.9e-9	PFAM
VWC	871	941	8.52e-3	SMART
VWD	898	1060	1.59e-30	SMART
C8	1096	1170	5.52e-31	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
internal_repeat_3	1375	1560	6.78e-17	PROSPERO
internal_repeat_2	1426	1751	8.94e-34	PROSPERO
low complexity region	1761	1780	N/A	INTRINSIC
low complexity region	1867	1887	N/A	INTRINSIC
low complexity region	1896	1910	N/A	INTRINSIC
low complexity region	1912	1946	N/A	INTRINSIC
low complexity region	1990	2004	N/A	INTRINSIC
low complexity region	2010	2020	N/A	INTRINSIC
internal_repeat_2	2036	2430	8.94e-34	PROSPERO
internal_repeat_3	2329	2516	6.78e-17	PROSPERO
low complexity region	2519	2536	N/A	INTRINSIC
low complexity region	2564	2587	N/A	INTRINSIC
low complexity region	2605	2630	N/A	INTRINSIC
low complexity region	2642	2677	N/A	INTRINSIC
low complexity region	2729	2762	N/A	INTRINSIC
Blast:CT	2765	2852	1e-44	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189314

SMART Domains

Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	193	2.64e-27	SMART
C8	226	299	5.46e-3	SMART
Pfam:TIL	303	358	1.4e-13	PFAM
VWC	360	428	2.57e-7	SMART
VWD	387	550	4.81e-30	SMART
C8	586	662	8.84e-21	SMART
internal_repeat_2	665	754	5.76e-7	PROSPERO
Pfam:TIL	765	828	6.4e-9	PFAM
VWC	830	900	8.52e-3	SMART
VWD	857	1019	1.59e-30	SMART
C8	1055	1129	5.52e-31	SMART
low complexity region	1199	1228	N/A	INTRINSIC
low complexity region	1234	1252	N/A	INTRINSIC
low complexity region	1272	1296	N/A	INTRINSIC
low complexity region	1304	1333	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000190907
AA Change: T1534P

SMART Domains

Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: T1534P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWD	29	234	1.2e-16	SMART
C8	267	340	4.2e-7	SMART
Pfam:TIL	344	399	7.2e-11	PFAM
VWC_def	401	469	1.2e-9	SMART
VWD	428	591	2.4e-32	SMART
C8	627	703	6.7e-25	SMART
SCOP:d1coua_	706	769	5e-9	SMART
Pfam:TIL	806	869	3.3e-6	PFAM
VWC_def	871	941	4.1e-5	SMART
VWD	898	1060	7.7e-33	SMART
C8	1096	1170	4.2e-35	SMART
Blast:CT	1184	1236	2e-19	BLAST
low complexity region	1240	1269	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1313	1337	N/A	INTRINSIC
low complexity region	1345	1374	N/A	INTRINSIC
low complexity region	1406	1419	N/A	INTRINSIC
internal_repeat_1	1426	1822	3.44e-48	PROSPERO
low complexity region	1826	1845	N/A	INTRINSIC
low complexity region	1932	1952	N/A	INTRINSIC
low complexity region	1961	1975	N/A	INTRINSIC
low complexity region	1977	2011	N/A	INTRINSIC
low complexity region	2055	2069	N/A	INTRINSIC
low complexity region	2075	2085	N/A	INTRINSIC
internal_repeat_1	2101	2501	3.44e-48	PROSPERO
low complexity region	2504	2524	N/A	INTRINSIC
low complexity region	2584	2601	N/A	INTRINSIC
low complexity region	2629	2652	N/A	INTRINSIC
low complexity region	2670	2695	N/A	INTRINSIC
low complexity region	2707	2742	N/A	INTRINSIC
low complexity region	2794	2827	N/A	INTRINSIC
Blast:CT	2830	2917	1e-44	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (94/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	A	G	1: 181,055,384 (GRCm39)		noncoding transcript	Het
Acp2	A	T	2: 91,041,068 (GRCm39)	R419W	probably benign	Het
Actr5	A	G	2: 158,469,991 (GRCm39)	N207S	probably damaging	Het
Afap1	G	A	5: 36,119,126 (GRCm39)	V254M	probably benign	Het
Arfgef1	A	T	1: 10,259,836 (GRCm39)	M544K	possibly damaging	Het
Arhgap5	A	T	12: 52,565,860 (GRCm39)	M944L	probably benign	Het
Bnip3l-ps	G	A	12: 18,266,773 (GRCm39)		noncoding transcript	Het
Carf	A	G	1: 60,148,477 (GRCm39)	T58A	probably benign	Het
Carns1	A	G	19: 4,220,927 (GRCm39)		probably benign	Het
Ccp110	T	A	7: 118,323,771 (GRCm39)	I670K	possibly damaging	Het
Cftr	T	A	6: 18,299,882 (GRCm39)	D1218E	probably benign	Het
Chrna9	A	T	5: 66,125,214 (GRCm39)	T52S	probably damaging	Het
Chst9	T	C	18: 15,585,834 (GRCm39)	Y243C	probably damaging	Het
Ciao3	A	T	17: 26,000,283 (GRCm39)	H322L	probably damaging	Het
Cilk1	A	G	9: 78,057,936 (GRCm39)	T162A	probably damaging	Het
Clk2	A	T	3: 89,076,016 (GRCm39)	H62L	probably benign	Het
Cntnap2	A	T	6: 45,037,251 (GRCm39)	R10W	possibly damaging	Het
Cpt1b	C	T	15: 89,305,609 (GRCm39)	D369N	probably benign	Het
Crhr2	G	T	6: 55,068,290 (GRCm39)	H423Q	probably damaging	Het
D8Ertd738e	T	A	8: 84,976,150 (GRCm39)	I33F	probably damaging	Het
Dbt	T	C	3: 116,332,781 (GRCm39)	I200T	probably damaging	Het
Ddhd1	A	T	14: 45,866,278 (GRCm39)		probably benign	Het
Ddx27	A	G	2: 166,871,219 (GRCm39)	I480V	probably benign	Het
Dpp9	A	C	17: 56,505,970 (GRCm39)		probably null	Het
Dpy19l3	A	T	7: 35,402,926 (GRCm39)	M562K	probably damaging	Het
Dus3l	T	C	17: 57,074,868 (GRCm39)	L330P	probably damaging	Het
Efcab7	C	T	4: 99,719,805 (GRCm39)	Q96*	probably null	Het
Egfr	T	C	11: 16,819,231 (GRCm39)	F254L	probably damaging	Het
Eml5	C	T	12: 98,765,111 (GRCm39)	V1566M	probably damaging	Het
Entpd7	T	A	19: 43,679,634 (GRCm39)	Y62*	probably null	Het
Erbb4	T	C	1: 68,383,059 (GRCm39)	M313V	probably damaging	Het
Gm5528	A	G	1: 72,043,711 (GRCm39)		noncoding transcript	Het
H2-M9	G	T	17: 36,951,631 (GRCm39)	Y281*	probably null	Het
Hmcn1	T	G	1: 150,565,346 (GRCm39)	K2260N	possibly damaging	Het
Hnf4a	A	G	2: 163,406,139 (GRCm39)	I259V	probably benign	Het
Insm1	A	T	2: 146,064,822 (GRCm39)	T213S	probably benign	Het
Iqca1	T	C	1: 90,005,544 (GRCm39)	D488G	probably damaging	Het
Kdm5a	T	A	6: 120,382,976 (GRCm39)		probably benign	Het
Kdm7a	G	C	6: 39,129,773 (GRCm39)	L468V	possibly damaging	Het
Lck	G	A	4: 129,449,777 (GRCm39)	T229I	possibly damaging	Het
Lig3	T	C	11: 82,678,553 (GRCm39)	L265P	probably damaging	Het
Lipa	T	A	19: 34,479,034 (GRCm39)	K229*	probably null	Het
Lrrk1	C	T	7: 65,956,621 (GRCm39)	S418N	probably benign	Het
Mark2	A	G	19: 7,258,597 (GRCm39)	V126A	probably damaging	Het
Met	T	C	6: 17,491,540 (GRCm39)	C101R	probably damaging	Het
Mkln1	A	T	6: 31,403,734 (GRCm39)	K85M	probably damaging	Het
Mst1	A	G	9: 107,957,720 (GRCm39)	R15G	probably benign	Het
Myo7b	T	C	18: 32,131,655 (GRCm39)	S514G	probably damaging	Het
Nars1	T	C	18: 64,649,498 (GRCm39)	E11G	probably benign	Het
Ogdh	T	A	11: 6,247,044 (GRCm39)	F23I	probably benign	Het
Or10g9	A	T	9: 39,911,718 (GRCm39)	D268E	probably damaging	Het
Or12e9	T	C	2: 87,202,665 (GRCm39)	I263T	probably damaging	Het
Or4a39	C	T	2: 89,236,830 (GRCm39)	V198I	probably benign	Het
Or4b1b	A	G	2: 90,112,725 (GRCm39)	S65P	probably damaging	Het
Or4c100	C	T	2: 88,356,569 (GRCm39)	S214F	probably damaging	Het
Or52r1c	C	T	7: 102,735,121 (GRCm39)	A127V	probably damaging	Het
Or9k2	T	A	10: 129,998,707 (GRCm39)	T163S	probably benign	Het
Otub2	T	A	12: 103,359,103 (GRCm39)	L64Q	probably benign	Het
Pappa2	T	C	1: 158,784,582 (GRCm39)	R143G	probably benign	Het
Patl2	T	A	2: 121,955,787 (GRCm39)	T250S	probably damaging	Het
Pcdhac2	C	T	18: 37,278,952 (GRCm39)	T644I	possibly damaging	Het
Pi4kb	C	T	3: 94,911,649 (GRCm39)	T690I	probably damaging	Het
Pla2g4d	T	C	2: 120,097,271 (GRCm39)	Y776C	probably benign	Het
Plekhh2	C	T	17: 84,871,387 (GRCm39)	S215L	probably benign	Het
Psmd2	T	G	16: 20,478,565 (GRCm39)		probably benign	Het
Ptpn21	T	C	12: 98,675,103 (GRCm39)	E183G	probably benign	Het
Ptprg	T	A	14: 12,226,314 (GRCm38)	D527E	probably damaging	Het
Rhobtb1	T	A	10: 69,115,327 (GRCm39)		probably null	Het
Scel	T	A	14: 103,809,473 (GRCm39)	M271K	possibly damaging	Het
Senp3	A	T	11: 69,569,655 (GRCm39)	C310*	probably null	Het
Slc25a3	T	C	10: 90,958,050 (GRCm39)	T97A	possibly damaging	Het
Srsf11	A	T	3: 157,732,369 (GRCm39)	Y82*	probably null	Het
Tbc1d8	G	A	1: 39,441,959 (GRCm39)	T211I	possibly damaging	Het
Tbkbp1	T	C	11: 97,039,474 (GRCm39)	E145G	probably damaging	Het
Tln1	T	C	4: 43,540,588 (GRCm39)	N1471S	probably benign	Het
Tnn	T	G	1: 159,973,659 (GRCm39)	D236A	probably damaging	Het
Trmt2a	C	T	16: 18,069,150 (GRCm39)		probably benign	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Ubxn10	G	A	4: 138,463,259 (GRCm39)		probably benign	Het
Ulk4	G	A	9: 120,902,938 (GRCm39)	Q1180*	probably null	Het
Usp43	T	A	11: 67,746,331 (GRCm39)	K1120N	probably damaging	Het
Uspl1	T	A	5: 149,131,149 (GRCm39)	L244Q	possibly damaging	Het
Vmn1r32	T	C	6: 66,530,629 (GRCm39)	H49R	probably damaging	Het
Vmn2r4	T	C	3: 64,317,384 (GRCm39)	D118G	probably damaging	Het
Vwce	A	G	19: 10,627,943 (GRCm39)	I468V	probably benign	Het
Zbtb7c	G	T	18: 76,279,225 (GRCm39)	R561L	probably benign	Het
Zfp956	T	C	6: 47,939,476 (GRCm39)	S175P	probably damaging	Het

Other mutations in Muc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL00466:Muc6	APN	7	141,232,169 (GRCm39)	missense	possibly damaging	0.94
IGL00990:Muc6	APN	7	141,638,890 (GRCm38)	missense	possibly damaging	0.85
IGL01013:Muc6	APN	7	141,234,333 (GRCm39)	nonsense	probably null
IGL01021:Muc6	APN	7	141,217,075 (GRCm39)	missense	possibly damaging	0.53
IGL01061:Muc6	APN	7	141,234,720 (GRCm39)	missense	probably damaging	1.00
IGL01294:Muc6	APN	7	141,232,926 (GRCm39)	missense	probably damaging	1.00
IGL01449:Muc6	APN	7	141,218,527 (GRCm39)	missense	possibly damaging	0.92
IGL01474:Muc6	APN	7	141,237,572 (GRCm39)	missense	probably damaging	1.00
IGL01539:Muc6	APN	7	141,236,306 (GRCm39)	missense	probably benign	0.07
IGL01541:Muc6	APN	7	141,236,069 (GRCm39)	nonsense	probably null
IGL01810:Muc6	APN	7	141,237,327 (GRCm39)	missense	probably damaging	0.97
IGL01941:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL01954:Muc6	APN	7	141,218,497 (GRCm39)	missense	probably benign	0.06
IGL02096:Muc6	APN	7	141,226,117 (GRCm39)	intron	probably benign
IGL02192:Muc6	APN	7	141,217,717 (GRCm39)	missense	possibly damaging	0.91
IGL02217:Muc6	APN	7	141,235,889 (GRCm39)	missense	probably damaging	1.00
IGL02234:Muc6	APN	7	141,226,842 (GRCm39)	missense	probably benign	0.09
IGL02302:Muc6	APN	7	141,227,763 (GRCm39)	missense	possibly damaging	0.53
IGL02331:Muc6	APN	7	141,226,726 (GRCm39)	missense	possibly damaging	0.53
IGL02531:Muc6	APN	7	141,216,853 (GRCm39)	missense	possibly damaging	0.53
IGL02639:Muc6	APN	7	141,235,843 (GRCm39)	splice site	probably benign
IGL02851:Muc6	APN	7	141,234,627 (GRCm39)	missense	probably damaging	1.00
IGL03026:Muc6	APN	7	141,226,414 (GRCm39)	intron	probably benign
IGL03070:Muc6	APN	7	141,230,834 (GRCm39)	splice site	probably benign
IGL03108:Muc6	APN	7	141,217,402 (GRCm39)	missense	possibly damaging	0.93
IGL03350:Muc6	APN	7	141,238,324 (GRCm39)	missense	probably damaging	1.00
IGL03366:Muc6	APN	7	141,234,349 (GRCm39)	missense	probably damaging	1.00
anticipation	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
F5770:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
IGL03147:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0001:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R0005:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0147:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R0153:Muc6	UTSW	7	141,214,029 (GRCm39)	missense	possibly damaging	0.68
R0227:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0234:Muc6	UTSW	7	141,235,939 (GRCm39)	missense	possibly damaging	0.95
R0304:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0379:Muc6	UTSW	7	141,216,868 (GRCm39)	missense	possibly damaging	0.53
R0385:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R0423:Muc6	UTSW	7	141,238,548 (GRCm39)	missense	probably benign	0.01
R0499:Muc6	UTSW	7	141,226,735 (GRCm39)	missense	probably benign
R0503:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R0757:Muc6	UTSW	7	141,218,497 (GRCm39)	missense	probably benign	0.06
R0792:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R0880:Muc6	UTSW	7	141,217,270 (GRCm39)	missense	possibly damaging	0.91
R1136:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1170:Muc6	UTSW	7	141,230,500 (GRCm39)	missense	probably damaging	0.99
R1174:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1175:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R1189:Muc6	UTSW	7	141,232,122 (GRCm39)	missense	probably damaging	1.00
R1259:Muc6	UTSW	7	141,226,464 (GRCm39)	intron	probably benign
R1293:Muc6	UTSW	7	141,238,255 (GRCm39)	missense	probably damaging	1.00
R1295:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1296:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1471:Muc6	UTSW	7	141,234,176 (GRCm39)	missense	possibly damaging	0.61
R1472:Muc6	UTSW	7	141,238,144 (GRCm39)	missense	probably benign	0.04
R1548:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R1548:Muc6	UTSW	7	141,238,368 (GRCm39)	splice site	probably benign
R1576:Muc6	UTSW	7	141,214,437 (GRCm39)	missense	possibly damaging	0.92
R1689:Muc6	UTSW	7	141,234,265 (GRCm39)	missense	probably damaging	1.00
R1702:Muc6	UTSW	7	141,236,752 (GRCm39)	missense	probably damaging	1.00
R1792:Muc6	UTSW	7	141,214,371 (GRCm39)	missense	probably benign	0.41
R1924:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R1938:Muc6	UTSW	7	141,217,011 (GRCm39)	missense	probably damaging	0.99
R1964:Muc6	UTSW	7	141,226,330 (GRCm39)	intron	probably benign
R1964:Muc6	UTSW	7	141,226,329 (GRCm39)	nonsense	probably null
R1975:Muc6	UTSW	7	141,234,368 (GRCm39)	missense	probably damaging	1.00
R2031:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2104:Muc6	UTSW	7	141,213,991 (GRCm39)	missense	probably benign	0.23
R2201:Muc6	UTSW	7	141,236,075 (GRCm39)	missense	probably damaging	1.00
R2218:Muc6	UTSW	7	141,233,227 (GRCm39)	missense	probably benign	0.41
R2245:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2261:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R2271:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2272:Muc6	UTSW	7	141,217,423 (GRCm39)	missense	possibly damaging	0.53
R2284:Muc6	UTSW	7	141,217,837 (GRCm39)	missense	possibly damaging	0.53
R2310:Muc6	UTSW	7	141,217,444 (GRCm39)	missense	possibly damaging	0.53
R2566:Muc6	UTSW	7	141,226,651 (GRCm39)	missense	possibly damaging	0.73
R2975:Muc6	UTSW	7	141,216,951 (GRCm39)	missense	possibly damaging	0.86
R3406:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3423:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3548:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R3693:Muc6	UTSW	7	141,234,946 (GRCm39)	splice site	probably benign
R3872:Muc6	UTSW	7	141,226,867 (GRCm39)	missense	probably benign
R4029:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4084:Muc6	UTSW	7	141,234,920 (GRCm39)	missense	probably damaging	1.00
R4126:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4410:Muc6	UTSW	7	141,217,576 (GRCm39)	missense	possibly damaging	0.91
R4508:Muc6	UTSW	7	141,226,356 (GRCm39)	intron	probably benign
R4509:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R4518:Muc6	UTSW	7	141,230,489 (GRCm39)	missense	probably benign	0.03
R4594:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4677:Muc6	UTSW	7	141,224,212 (GRCm39)	intron	probably benign
R4678:Muc6	UTSW	7	141,230,554 (GRCm39)	missense	probably benign	0.09
R4737:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R4981:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
R5008:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5012:Muc6	UTSW	7	141,216,570 (GRCm39)	missense	possibly damaging	0.96
R5017:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	probably benign
R5027:Muc6	UTSW	7	141,216,349 (GRCm39)	missense	probably benign	0.01
R5058:Muc6	UTSW	7	141,230,491 (GRCm39)	missense	probably benign	0.01
R5069:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5126:Muc6	UTSW	7	141,237,564 (GRCm39)	missense	probably damaging	1.00
R5168:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R5179:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5198:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R5262:Muc6	UTSW	7	141,237,375 (GRCm39)	missense	possibly damaging	0.78
R5381:Muc6	UTSW	7	141,217,836 (GRCm39)	missense	possibly damaging	0.86
R5454:Muc6	UTSW	7	141,235,078 (GRCm39)	missense	possibly damaging	0.61
R5467:Muc6	UTSW	7	141,216,448 (GRCm39)	missense	possibly damaging	0.53
R5540:Muc6	UTSW	7	141,235,850 (GRCm39)	critical splice donor site	probably null
R5800:Muc6	UTSW	7	141,226,690 (GRCm39)	splice site	probably benign
R5808:Muc6	UTSW	7	141,226,360 (GRCm39)	intron	probably benign
R5865:Muc6	UTSW	7	141,236,769 (GRCm39)	missense	probably damaging	0.97
R5919:Muc6	UTSW	7	141,227,837 (GRCm39)	missense	possibly damaging	0.56
R6024:Muc6	UTSW	7	141,227,841 (GRCm39)	missense	possibly damaging	0.53
R6064:Muc6	UTSW	7	141,234,640 (GRCm39)	missense	probably damaging	1.00
R6126:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6229:Muc6	UTSW	7	141,226,792 (GRCm39)	missense	probably benign
R6236:Muc6	UTSW	7	141,218,685 (GRCm39)	missense	possibly damaging	0.72
R6245:Muc6	UTSW	7	141,235,086 (GRCm39)	missense	probably damaging	1.00
R6254:Muc6	UTSW	7	141,237,380 (GRCm39)	missense	probably benign	0.09
R6418:Muc6	UTSW	7	141,224,032 (GRCm39)	intron	probably benign
R6609:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6610:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6611:Muc6	UTSW	7	141,226,700 (GRCm39)	splice site	probably benign
R6623:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6626:Muc6	UTSW	7	141,223,981 (GRCm39)	intron	probably benign
R6817:Muc6	UTSW	7	141,237,326 (GRCm39)	missense	probably damaging	0.99
R6923:Muc6	UTSW	7	141,217,453 (GRCm39)	missense	possibly damaging	0.91
R6989:Muc6	UTSW	7	141,226,246 (GRCm39)	intron	probably benign
R7001:Muc6	UTSW	7	141,217,320 (GRCm39)	missense	probably damaging	0.99
R7046:Muc6	UTSW	7	141,226,456 (GRCm39)	intron	probably benign
R7097:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7099:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7101:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7107:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7108:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7112:Muc6	UTSW	7	141,235,542 (GRCm39)	missense	probably damaging	1.00
R7202:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7204:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7205:Muc6	UTSW	7	141,214,363 (GRCm39)	frame shift	probably null
R7222:Muc6	UTSW	7	141,214,428 (GRCm39)	missense	unknown
R7230:Muc6	UTSW	7	141,235,479 (GRCm39)	missense	probably damaging	1.00
R7278:Muc6	UTSW	7	141,226,842 (GRCm39)	missense	probably benign	0.09
R7483:Muc6	UTSW	7	141,224,245 (GRCm39)	missense	unknown
R7501:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7601:Muc6	UTSW	7	141,216,454 (GRCm39)	missense	unknown
R7641:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7644:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7645:Muc6	UTSW	7	141,234,923 (GRCm39)	missense	probably benign	0.40
R7659:Muc6	UTSW	7	141,216,973 (GRCm39)	missense	possibly damaging	0.53
R7674:Muc6	UTSW	7	141,224,247 (GRCm39)	missense	unknown
R7679:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7680:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7689:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7690:Muc6	UTSW	7	141,217,659 (GRCm39)	missense	probably damaging	0.98
R7760:Muc6	UTSW	7	141,237,322 (GRCm39)	splice site	probably null
R7806:Muc6	UTSW	7	141,217,387 (GRCm39)	missense	possibly damaging	0.53
R7809:Muc6	UTSW	7	141,226,638 (GRCm39)	missense	probably benign	0.02
R7848:Muc6	UTSW	7	141,232,188 (GRCm39)	missense	possibly damaging	0.53
R7859:Muc6	UTSW	7	141,231,687 (GRCm39)	missense	probably damaging	0.96
R8054:Muc6	UTSW	7	141,231,748 (GRCm39)	missense	probably damaging	1.00
R8085:Muc6	UTSW	7	141,226,729 (GRCm39)	missense	unknown
R8130:Muc6	UTSW	7	141,233,354 (GRCm39)	missense	probably damaging	0.97
R8210:Muc6	UTSW	7	141,235,673 (GRCm39)	critical splice donor site	probably null
R8273:Muc6	UTSW	7	141,226,795 (GRCm39)	missense	unknown
R8294:Muc6	UTSW	7	141,217,263 (GRCm39)	missense	possibly damaging	0.96
R8329:Muc6	UTSW	7	141,226,525 (GRCm39)	missense	unknown
R8379:Muc6	UTSW	7	141,230,579 (GRCm39)	nonsense	probably null
R8537:Muc6	UTSW	7	141,234,184 (GRCm39)	missense	probably benign	0.03
R8736:Muc6	UTSW	7	141,228,439 (GRCm39)	missense	possibly damaging	0.53
R8767:Muc6	UTSW	7	141,229,549 (GRCm39)	missense	probably damaging	1.00
R8902:Muc6	UTSW	7	141,233,791 (GRCm39)	missense	possibly damaging	0.93
R9009:Muc6	UTSW	7	141,217,018 (GRCm39)	missense	possibly damaging	0.73
R9010:Muc6	UTSW	7	141,226,351 (GRCm39)	missense	unknown
R9023:Muc6	UTSW	7	141,237,432 (GRCm39)	nonsense	probably null
R9058:Muc6	UTSW	7	141,218,154 (GRCm39)	missense	possibly damaging	0.61
R9257:Muc6	UTSW	7	141,226,738 (GRCm39)	missense	unknown
R9495:Muc6	UTSW	7	141,237,398 (GRCm39)	missense	probably damaging	0.98
R9563:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9645:Muc6	UTSW	7	141,217,783 (GRCm39)	missense	possibly damaging	0.53
R9659:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
R9733:Muc6	UTSW	7	141,216,310 (GRCm39)	missense	unknown
R9787:Muc6	UTSW	7	141,227,748 (GRCm39)	nonsense	probably null
R9788:Muc6	UTSW	7	141,232,100 (GRCm39)	missense	probably damaging	1.00
V7581:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
V7583:Muc6	UTSW	7	141,233,880 (GRCm39)	missense	probably benign	0.11
X0026:Muc6	UTSW	7	141,237,964 (GRCm39)	missense	possibly damaging	0.94
X0058:Muc6	UTSW	7	141,218,313 (GRCm39)	missense	possibly damaging	0.95
Z1177:Muc6	UTSW	7	141,237,656 (GRCm39)	missense	probably benign	0.20
Z1177:Muc6	UTSW	7	141,236,701 (GRCm39)	missense	probably benign	0.29
Z1177:Muc6	UTSW	7	141,217,827 (GRCm39)	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CTGTGGAGAAAGAGCTTTGAGC -3'
(R):5'- CAACGGAGTGAGTGATACCC -3'

Sequencing Primer
(F):5'- AGCTTGAGTGATGGAGCTAGTTATAG -3'
(R):5'- AGTGAGTGATACCCCTGGG -3'

Posted On

2015-11-11