Incidental Mutation 'R4737:Mst1'
ID 359351
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Name macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms D3F15S2h, D9H3F15S2, DNF15S2h, Hgfl
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107957635-107962202 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107957720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 15 (R15G)
Ref Sequence ENSEMBL: ENSMUSP00000125175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000162886] [ENSMUST00000161828] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000178267] [ENSMUST00000174504] [ENSMUST00000162516] [ENSMUST00000193254]
AlphaFold P26928
Predicted Effect probably benign
Transcript: ENSMUST00000035211
AA Change: R15G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: R15G

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect unknown
Transcript: ENSMUST00000160184
AA Change: R13G
Predicted Effect probably benign
Transcript: ENSMUST00000162886
AA Change: R15G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: R15G

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 107,958,800 (GRCm39) missense probably benign 0.03
IGL01380:Mst1 APN 9 107,961,787 (GRCm39) missense probably damaging 1.00
IGL01420:Mst1 APN 9 107,960,027 (GRCm39) missense probably damaging 0.99
IGL02931:Mst1 APN 9 107,961,841 (GRCm39) splice site probably null
IGL03059:Mst1 APN 9 107,962,012 (GRCm39) missense probably damaging 1.00
IGL03275:Mst1 APN 9 107,961,587 (GRCm39) missense possibly damaging 0.70
R0319:Mst1 UTSW 9 107,959,712 (GRCm39) missense probably benign 0.05
R0361:Mst1 UTSW 9 107,962,096 (GRCm39) missense probably damaging 0.98
R0412:Mst1 UTSW 9 107,960,793 (GRCm39) missense probably benign 0.06
R0569:Mst1 UTSW 9 107,959,500 (GRCm39) missense probably damaging 0.98
R1432:Mst1 UTSW 9 107,961,403 (GRCm39) missense probably benign 0.01
R1483:Mst1 UTSW 9 107,958,849 (GRCm39) missense probably benign 0.03
R1859:Mst1 UTSW 9 107,961,545 (GRCm39) missense probably benign 0.23
R2187:Mst1 UTSW 9 107,961,539 (GRCm39) missense possibly damaging 0.63
R2393:Mst1 UTSW 9 107,960,151 (GRCm39) critical splice donor site probably null
R3522:Mst1 UTSW 9 107,958,702 (GRCm39) unclassified probably benign
R3916:Mst1 UTSW 9 107,961,494 (GRCm39) missense probably benign 0.00
R3917:Mst1 UTSW 9 107,961,494 (GRCm39) missense probably benign 0.00
R3945:Mst1 UTSW 9 107,962,052 (GRCm39) missense probably damaging 1.00
R4006:Mst1 UTSW 9 107,960,147 (GRCm39) missense possibly damaging 0.52
R4007:Mst1 UTSW 9 107,960,147 (GRCm39) missense possibly damaging 0.52
R4756:Mst1 UTSW 9 107,960,826 (GRCm39) missense probably benign 0.28
R5047:Mst1 UTSW 9 107,961,508 (GRCm39) missense probably benign 0.17
R5113:Mst1 UTSW 9 107,959,446 (GRCm39) missense probably damaging 1.00
R5278:Mst1 UTSW 9 107,959,414 (GRCm39) missense probably damaging 0.99
R5279:Mst1 UTSW 9 107,959,414 (GRCm39) missense probably damaging 0.99
R5402:Mst1 UTSW 9 107,961,408 (GRCm39) critical splice donor site probably null
R5677:Mst1 UTSW 9 107,958,485 (GRCm39) missense probably damaging 0.98
R5712:Mst1 UTSW 9 107,960,107 (GRCm39) missense probably damaging 1.00
R6717:Mst1 UTSW 9 107,957,774 (GRCm39) splice site probably null
R7059:Mst1 UTSW 9 107,961,263 (GRCm39) missense probably benign 0.44
R7131:Mst1 UTSW 9 107,962,130 (GRCm39) missense probably null 0.07
R7139:Mst1 UTSW 9 107,960,027 (GRCm39) missense probably damaging 0.99
R7219:Mst1 UTSW 9 107,958,485 (GRCm39) missense probably damaging 0.99
R7501:Mst1 UTSW 9 107,959,748 (GRCm39) missense probably damaging 1.00
R7878:Mst1 UTSW 9 107,961,812 (GRCm39) missense probably benign
R8304:Mst1 UTSW 9 107,958,803 (GRCm39) missense probably benign
R8397:Mst1 UTSW 9 107,958,698 (GRCm39) critical splice donor site probably benign
R8715:Mst1 UTSW 9 107,959,242 (GRCm39) missense possibly damaging 0.95
R9574:Mst1 UTSW 9 107,962,053 (GRCm39) nonsense probably null
R9732:Mst1 UTSW 9 107,959,425 (GRCm39) missense possibly damaging 0.93
X0028:Mst1 UTSW 9 107,959,416 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTCAGTCAAGTCCAGG -3'
(R):5'- CTGGTTGAAAGACTGCCTCTG -3'

Sequencing Primer
(F):5'- TCAGTCAAGTCCAGGCAGGTTC -3'
(R):5'- GCTCTAATGTAGTCCTGATCAGACTG -3'
Posted On 2015-11-11