Incidental Mutation 'R4737:Ulk4'
ID 359353
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 120902938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1180 (Q1180*)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051479
AA Change: Q1180*
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: Q1180*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170406
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATCTGTCTCTCAAGAGC -3'
(R):5'- TGACGAACCACCTGGATTCC -3'

Sequencing Primer
(F):5'- CCTGGCCTAAAGTCAAGT -3'
(R):5'- GAACCACCTGGATTCCATGCATTTC -3'
Posted On 2015-11-11