Incidental Mutation 'R4737:Egfr'
ID 359358
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Name epidermal growth factor receptor
Synonyms 9030024J15Rik, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, Errb1, Erbb
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 16702203-16868158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16819231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 254 (F254L)
Ref Sequence ENSEMBL: ENSMUSP00000099948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]
AlphaFold Q01279
Predicted Effect possibly damaging
Transcript: ENSMUST00000020329
AA Change: F254L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: F254L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102884
AA Change: F254L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: F254L

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Meta Mutation Damage Score 0.9132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16,813,020 (GRCm39) missense probably damaging 1.00
IGL01529:Egfr APN 11 16,813,014 (GRCm39) missense probably benign
IGL01556:Egfr APN 11 16,855,382 (GRCm39) missense probably damaging 1.00
IGL02627:Egfr APN 11 16,819,346 (GRCm39) missense probably damaging 1.00
IGL02862:Egfr APN 11 16,833,562 (GRCm39) missense probably benign 0.25
IGL02945:Egfr APN 11 16,702,514 (GRCm39) missense probably damaging 1.00
IGL02994:Egfr APN 11 16,861,811 (GRCm39) missense probably damaging 1.00
IGL03395:Egfr APN 11 16,860,261 (GRCm39) splice site probably benign
set UTSW 11 16,821,881 (GRCm39) splice site probably benign
Velvet UTSW 11 16,854,399 (GRCm39) missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16,860,214 (GRCm39) missense probably benign 0.00
R0196:Egfr UTSW 11 16,861,746 (GRCm39) missense probably benign 0.02
R0513:Egfr UTSW 11 16,822,855 (GRCm39) missense probably damaging 1.00
R0567:Egfr UTSW 11 16,822,873 (GRCm39) missense probably benign 0.01
R0629:Egfr UTSW 11 16,819,333 (GRCm39) missense probably damaging 1.00
R0961:Egfr UTSW 11 16,812,964 (GRCm39) missense probably damaging 1.00
R1163:Egfr UTSW 11 16,833,546 (GRCm39) missense probably benign 0.02
R1454:Egfr UTSW 11 16,839,920 (GRCm39) missense probably benign
R1456:Egfr UTSW 11 16,813,065 (GRCm39) missense probably benign 0.00
R1503:Egfr UTSW 11 16,819,301 (GRCm39) missense possibly damaging 0.86
R1577:Egfr UTSW 11 16,819,241 (GRCm39) missense probably benign 0.04
R1595:Egfr UTSW 11 16,856,847 (GRCm39) missense probably damaging 0.99
R1699:Egfr UTSW 11 16,809,019 (GRCm39) missense probably benign 0.14
R2172:Egfr UTSW 11 16,861,562 (GRCm39) missense probably benign 0.00
R3690:Egfr UTSW 11 16,821,881 (GRCm39) splice site probably benign
R3922:Egfr UTSW 11 16,831,495 (GRCm39) missense probably damaging 1.00
R4444:Egfr UTSW 11 16,821,027 (GRCm39) missense probably benign 0.00
R4685:Egfr UTSW 11 16,808,980 (GRCm39) missense probably damaging 1.00
R4814:Egfr UTSW 11 16,819,354 (GRCm39) missense probably damaging 1.00
R4841:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4842:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4903:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4964:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4985:Egfr UTSW 11 16,809,029 (GRCm39) nonsense probably null
R4998:Egfr UTSW 11 16,831,493 (GRCm39) missense possibly damaging 0.58
R5001:Egfr UTSW 11 16,854,434 (GRCm39) missense probably damaging 0.98
R5304:Egfr UTSW 11 16,834,260 (GRCm39) missense probably benign
R5309:Egfr UTSW 11 16,861,703 (GRCm39) missense probably benign 0.00
R5653:Egfr UTSW 11 16,861,617 (GRCm39) missense probably benign 0.04
R5905:Egfr UTSW 11 16,861,494 (GRCm39) missense probably damaging 1.00
R6051:Egfr UTSW 11 16,833,607 (GRCm39) missense possibly damaging 0.87
R6052:Egfr UTSW 11 16,861,554 (GRCm39) missense probably benign 0.16
R6114:Egfr UTSW 11 16,854,374 (GRCm39) missense possibly damaging 0.46
R6261:Egfr UTSW 11 16,839,964 (GRCm39) missense probably benign 0.11
R6434:Egfr UTSW 11 16,819,294 (GRCm39) missense probably benign 0.25
R6475:Egfr UTSW 11 16,841,259 (GRCm39) missense probably benign
R6799:Egfr UTSW 11 16,846,952 (GRCm39) missense probably damaging 1.00
R7143:Egfr UTSW 11 16,821,627 (GRCm39) missense probably benign 0.20
R7195:Egfr UTSW 11 16,818,162 (GRCm39) missense probably damaging 1.00
R7459:Egfr UTSW 11 16,846,967 (GRCm39) missense probably damaging 1.00
R7612:Egfr UTSW 11 16,809,025 (GRCm39) missense possibly damaging 0.74
R7757:Egfr UTSW 11 16,839,966 (GRCm39) missense possibly damaging 0.64
R7763:Egfr UTSW 11 16,841,266 (GRCm39) missense probably damaging 1.00
R8315:Egfr UTSW 11 16,825,027 (GRCm39) missense probably benign 0.08
R8320:Egfr UTSW 11 16,841,251 (GRCm39) missense probably damaging 1.00
R8324:Egfr UTSW 11 16,858,885 (GRCm39) missense probably damaging 0.98
R8324:Egfr UTSW 11 16,808,971 (GRCm39) missense probably damaging 0.99
R8347:Egfr UTSW 11 16,828,174 (GRCm39) missense probably damaging 1.00
R8440:Egfr UTSW 11 16,859,831 (GRCm39) missense probably damaging 1.00
R8511:Egfr UTSW 11 16,846,949 (GRCm39) missense probably damaging 1.00
R8708:Egfr UTSW 11 16,817,300 (GRCm39) critical splice donor site probably benign
R8804:Egfr UTSW 11 16,819,339 (GRCm39) missense probably benign 0.09
R8853:Egfr UTSW 11 16,858,885 (GRCm39) missense possibly damaging 0.93
R8906:Egfr UTSW 11 16,861,635 (GRCm39) missense probably damaging 1.00
R9177:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9268:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9335:Egfr UTSW 11 16,820,991 (GRCm39) missense probably damaging 1.00
R9417:Egfr UTSW 11 16,825,067 (GRCm39) nonsense probably null
R9454:Egfr UTSW 11 16,837,155 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,819,319 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,812,954 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGACTATCCTGGAAAGGCTTAC -3'
(R):5'- AGGCAGACACTAGCCTACAG -3'

Sequencing Primer
(F):5'- GACTATCCTGGAAAGGCTTACTAGAC -3'
(R):5'- TGCCCAGGACTCTAGCATAAG -3'
Posted On 2015-11-11