Mutagenetix > Incidental Mutations

Incidental Mutation 'R4737:Egfr'

359358

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

042024-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.915) question?

Stock #

R4737 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16869231 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 254 (F254L)

Ref Sequence

ENSEMBL: ENSMUSP00000099948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020329
AA Change: F254L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: F254L

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102884
AA Change: F254L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: F254L

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	5e-33	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	2e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.54e0	SMART

Meta Mutation Damage Score

0.9132

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (94/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	A	G	1: 181,227,819		noncoding transcript	Het
Acp2	A	T	2: 91,210,723	R419W	probably benign	Het
Actr5	A	G	2: 158,628,071	N207S	probably damaging	Het
Afap1	G	A	5: 35,961,782	V254M	probably benign	Het
Arfgef1	A	T	1: 10,189,611	M544K	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Bnip3l-ps	G	A	12: 18,216,772		noncoding transcript	Het
Carf	A	G	1: 60,109,318	T58A	probably benign	Het
Carns1	A	G	19: 4,170,928		probably benign	Het
Ccp110	T	A	7: 118,724,548	I670K	possibly damaging	Het
Cftr	T	A	6: 18,299,883	D1218E	probably benign	Het
Chrna9	A	T	5: 65,967,871	T52S	probably damaging	Het
Chst9	T	C	18: 15,452,777	Y243C	probably damaging	Het
Clk2	A	T	3: 89,168,709	H62L	probably benign	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Cpt1b	C	T	15: 89,421,406	D369N	probably benign	Het
Crhr2	G	T	6: 55,091,305	H423Q	probably damaging	Het
D8Ertd738e	T	A	8: 84,249,521	I33F	probably damaging	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Ddhd1	A	T	14: 45,628,821		probably benign	Het
Ddx27	A	G	2: 167,029,299	I480V	probably benign	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Dpy19l3	A	T	7: 35,703,501	M562K	probably damaging	Het
Dus3l	T	C	17: 56,767,868	L330P	probably damaging	Het
Efcab7	C	T	4: 99,831,568	Q96*	probably null	Het
Eml5	C	T	12: 98,798,852	V1566M	probably damaging	Het
Entpd7	T	A	19: 43,691,195	Y62*	probably null	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Gm5528	A	G	1: 72,004,552		noncoding transcript	Het
H2-M9	G	T	17: 36,640,739	Y281*	probably null	Het
Hmcn1	T	G	1: 150,689,595	K2260N	possibly damaging	Het
Hnf4a	A	G	2: 163,564,219	I259V	probably benign	Het
Ick	A	G	9: 78,150,654	T162A	probably damaging	Het
Insm1	A	T	2: 146,222,902	T213S	probably benign	Het
Iqca	T	C	1: 90,077,822	D488G	probably damaging	Het
Kdm5a	T	A	6: 120,406,015		probably benign	Het
Kdm7a	G	C	6: 39,152,839	L468V	possibly damaging	Het
Lck	G	A	4: 129,555,984	T229I	possibly damaging	Het
Lig3	T	C	11: 82,787,727	L265P	probably damaging	Het
Lipa	T	A	19: 34,501,634	K229*	probably null	Het
Lrrk1	C	T	7: 66,306,873	S418N	probably benign	Het
Mark2	A	G	19: 7,281,232	V126A	probably damaging	Het
Met	T	C	6: 17,491,541	C101R	probably damaging	Het
Mkln1	A	T	6: 31,426,799	K85M	probably damaging	Het
Mst1	A	G	9: 108,080,521	R15G	probably benign	Het
Muc6	T	G	7: 141,640,159		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Myo7b	T	C	18: 31,998,602	S514G	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nars	T	C	18: 64,516,427	E11G	probably benign	Het
Ogdh	T	A	11: 6,297,044	F23I	probably benign	Het
Olfr1121	T	C	2: 87,372,321	I263T	probably damaging	Het
Olfr1186	C	T	2: 88,526,225	S214F	probably damaging	Het
Olfr1238	C	T	2: 89,406,486	V198I	probably benign	Het
Olfr1272	A	G	2: 90,282,381	S65P	probably damaging	Het
Olfr584	C	T	7: 103,085,914	A127V	probably damaging	Het
Olfr825	T	A	10: 130,162,838	T163S	probably benign	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Patl2	T	A	2: 122,125,306	T250S	probably damaging	Het
Pcdhac2	C	T	18: 37,145,899	T644I	possibly damaging	Het
Pi4kb	C	T	3: 95,004,338	T690I	probably damaging	Het
Pla2g4d	T	C	2: 120,266,790	Y776C	probably benign	Het
Plekhh2	C	T	17: 84,563,959	S215L	probably benign	Het
Psmd2	T	G	16: 20,659,815		probably benign	Het
Ptpn21	T	C	12: 98,708,844	E183G	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rhobtb1	T	A	10: 69,279,497		probably null	Het
Scel	T	A	14: 103,572,037	M271K	possibly damaging	Het
Senp3	A	T	11: 69,678,829	C310*	probably null	Het
Slc25a3	T	C	10: 91,122,188	T97A	possibly damaging	Het
Srsf11	A	T	3: 158,026,732	Y82*	probably null	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,648	E145G	probably damaging	Het
Tln1	T	C	4: 43,540,588	N1471S	probably benign	Het
Tnn	T	G	1: 160,146,089	D236A	probably damaging	Het
Trmt2a	C	T	16: 18,251,286		probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubxn10	G	A	4: 138,735,948		probably benign	Het
Ulk4	G	A	9: 121,073,872	Q1180*	probably null	Het
Usp43	T	A	11: 67,855,505	K1120N	probably damaging	Het
Uspl1	T	A	5: 149,194,339	L244Q	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,645	H49R	probably damaging	Het
Vmn2r4	T	C	3: 64,409,963	D118G	probably damaging	Het
Vwce	A	G	19: 10,650,579	I468V	probably benign	Het
Zbtb7c	G	T	18: 76,146,154	R561L	probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0629:Egfr	UTSW	11	16869333	missense	probably damaging	1.00
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACTATCCTGGAAAGGCTTAC -3'
(R):5'- AGGCAGACACTAGCCTACAG -3'

Sequencing Primer
(F):5'- GACTATCCTGGAAAGGCTTACTAGAC -3'
(R):5'- TGCCCAGGACTCTAGCATAAG -3'

Posted On

2015-11-11