Incidental Mutation 'R4737:Lig3'
ID359361
Institutional Source Beutler Lab
Gene Symbol Lig3
Ensembl Gene ENSMUSG00000020697
Gene Nameligase III, DNA, ATP-dependent
SynonymsD11Wsu78e
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82781108-82804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82787727 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 265 (L265P)
Ref Sequence ENSEMBL: ENSMUSP00000133348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000131537] [ENSMUST00000173009] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173727]
Predicted Effect probably damaging
Transcript: ENSMUST00000021039
AA Change: L265P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080461
AA Change: L265P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092849
AA Change: L265P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131537
AA Change: L265P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133672
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172609
Predicted Effect probably damaging
Transcript: ENSMUST00000173009
AA Change: L265P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133348
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173347
AA Change: L264P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697
AA Change: L264P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173722
AA Change: L265P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697
AA Change: L265P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173727
AA Change: L264P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697
AA Change: L264P

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Meta Mutation Damage Score 0.8257 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Lig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lig3 APN 11 82797315 missense possibly damaging 0.90
IGL01577:Lig3 APN 11 82783477 missense probably benign 0.00
IGL01643:Lig3 APN 11 82798292 missense probably damaging 1.00
IGL01712:Lig3 APN 11 82789541 splice site probably benign
IGL01724:Lig3 APN 11 82790622 missense possibly damaging 0.95
IGL01749:Lig3 APN 11 82789867 missense probably damaging 1.00
IGL01778:Lig3 APN 11 82794541 missense probably damaging 1.00
IGL02798:Lig3 APN 11 82795705 splice site probably benign
IGL03007:Lig3 APN 11 82789575 missense probably damaging 1.00
IGL03178:Lig3 APN 11 82789722 splice site probably benign
R0001:Lig3 UTSW 11 82790591 missense probably damaging 1.00
R0115:Lig3 UTSW 11 82793935 missense probably damaging 1.00
R0834:Lig3 UTSW 11 82798287 missense probably damaging 0.99
R1460:Lig3 UTSW 11 82795798 splice site probably benign
R1602:Lig3 UTSW 11 82792194 critical splice donor site probably null
R1969:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1971:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1997:Lig3 UTSW 11 82787666 missense probably benign 0.00
R3817:Lig3 UTSW 11 82796115 missense possibly damaging 0.75
R4083:Lig3 UTSW 11 82790494 missense probably benign 0.31
R4084:Lig3 UTSW 11 82795424 missense probably damaging 1.00
R4665:Lig3 UTSW 11 82800250 missense probably damaging 0.99
R5212:Lig3 UTSW 11 82787678 missense probably benign
R5274:Lig3 UTSW 11 82797292 splice site probably null
R6320:Lig3 UTSW 11 82794007 critical splice donor site probably null
R6807:Lig3 UTSW 11 82783751 missense probably benign 0.00
R7103:Lig3 UTSW 11 82797312 missense probably benign 0.17
R7552:Lig3 UTSW 11 82788891 missense probably benign 0.00
R7646:Lig3 UTSW 11 82783478 missense probably benign 0.00
R7910:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R7991:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R8001:Lig3 UTSW 11 82792076 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGGGCTTGCATAAAATGGC -3'
(R):5'- AATTCCGATATACAAGTGTCTGCAC -3'

Sequencing Primer
(F):5'- GCTTGCATAAAATGGCATAAGC -3'
(R):5'- TGTCTGCACATCAAGCTGG -3'
Posted On2015-11-11