Incidental Mutation 'R4737:Tbkbp1'
ID 359362
Institutional Source Beutler Lab
Gene Symbol Tbkbp1
Ensembl Gene ENSMUSG00000038517
Gene Name TBK1 binding protein 1
Synonyms 3110043L15Rik
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97026997-97042321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97039474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 145 (E145G)
Ref Sequence ENSEMBL: ENSMUSP00000112396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066078] [ENSMUST00000107613] [ENSMUST00000107614] [ENSMUST00000107615] [ENSMUST00000118375] [ENSMUST00000146374]
AlphaFold A2A9T0
Predicted Effect probably damaging
Transcript: ENSMUST00000066078
AA Change: E145G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065461
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 287 342 2.8e-24 PFAM
low complexity region 343 432 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107613
AA Change: E145G

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103238
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107614
AA Change: E145G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103239
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 289 343 4.1e-21 PFAM
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107615
AA Change: E145G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103240
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118375
AA Change: E145G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112396
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146374
AA Change: E145G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114460
Gene: ENSMUSG00000038517
AA Change: E145G

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183796
Meta Mutation Damage Score 0.1400 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBKBP1 is an adaptor protein that binds to TBK1 (MIM 604834) and is part of the interaction network in the TNF (MIM 191160)/NFKB (see MIM 164011) pathway (Bouwmeester et al., 2004 [PubMed 14743216]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal GM-CSF-derived bone marrow-derived dendritic cell differentiation and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Tbkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Tbkbp1 APN 11 97,028,474 (GRCm39) unclassified probably benign
IGL01071:Tbkbp1 APN 11 97,040,388 (GRCm39) missense probably damaging 0.99
R0017:Tbkbp1 UTSW 11 97,037,115 (GRCm39) unclassified probably benign
R0445:Tbkbp1 UTSW 11 97,040,295 (GRCm39) missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97,039,814 (GRCm39) missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97,039,814 (GRCm39) missense probably damaging 1.00
R4198:Tbkbp1 UTSW 11 97,039,894 (GRCm39) critical splice acceptor site probably null
R4816:Tbkbp1 UTSW 11 97,029,567 (GRCm39) missense probably benign 0.23
R4910:Tbkbp1 UTSW 11 97,029,956 (GRCm39) missense probably benign 0.23
R4947:Tbkbp1 UTSW 11 97,029,770 (GRCm39) utr 3 prime probably benign
R5571:Tbkbp1 UTSW 11 97,039,555 (GRCm39) missense probably damaging 1.00
R6083:Tbkbp1 UTSW 11 97,038,206 (GRCm39) missense probably damaging 1.00
R6207:Tbkbp1 UTSW 11 97,037,165 (GRCm39) missense probably damaging 1.00
R6595:Tbkbp1 UTSW 11 97,029,578 (GRCm39) utr 3 prime probably benign
R7678:Tbkbp1 UTSW 11 97,040,309 (GRCm39) missense probably damaging 1.00
R7684:Tbkbp1 UTSW 11 97,038,559 (GRCm39) unclassified probably benign
R8425:Tbkbp1 UTSW 11 97,029,677 (GRCm39) missense unknown
R8495:Tbkbp1 UTSW 11 97,037,429 (GRCm39) missense probably benign 0.04
R8900:Tbkbp1 UTSW 11 97,040,327 (GRCm39) missense probably benign 0.00
R8964:Tbkbp1 UTSW 11 97,037,169 (GRCm39) missense probably damaging 1.00
R9006:Tbkbp1 UTSW 11 97,029,707 (GRCm39) missense unknown
X0020:Tbkbp1 UTSW 11 97,039,800 (GRCm39) missense probably damaging 0.99
Z1176:Tbkbp1 UTSW 11 97,040,354 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGCAGGCATTCACAGACAGG -3'
(R):5'- GCCTTCCCTAAATCAGCTTCAG -3'

Sequencing Primer
(F):5'- CATTCACAGACAGGGACGAGTG -3'
(R):5'- CGCTTCCTGTTTCTATTGGGAATAG -3'
Posted On 2015-11-11