Mutagenetix > Incidental Mutations

Incidental Mutation 'R4737:Eml5'

359366

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

042024-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R4737 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 98798852 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1566 (V1566M)

Ref Sequence

ENSEMBL: ENSMUSP00000065643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065716
AA Change: V1566M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V1566M

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

silent
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: V1613M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.2110

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (94/94)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	A	G	1: 181,227,819		noncoding transcript	Het
Acp2	A	T	2: 91,210,723	R419W	probably benign	Het
Actr5	A	G	2: 158,628,071	N207S	probably damaging	Het
Afap1	G	A	5: 35,961,782	V254M	probably benign	Het
Arfgef1	A	T	1: 10,189,611	M544K	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Bnip3l-ps	G	A	12: 18,216,772		noncoding transcript	Het
Carf	A	G	1: 60,109,318	T58A	probably benign	Het
Carns1	A	G	19: 4,170,928		probably benign	Het
Ccp110	T	A	7: 118,724,548	I670K	possibly damaging	Het
Cftr	T	A	6: 18,299,883	D1218E	probably benign	Het
Chrna9	A	T	5: 65,967,871	T52S	probably damaging	Het
Chst9	T	C	18: 15,452,777	Y243C	probably damaging	Het
Clk2	A	T	3: 89,168,709	H62L	probably benign	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Cpt1b	C	T	15: 89,421,406	D369N	probably benign	Het
Crhr2	G	T	6: 55,091,305	H423Q	probably damaging	Het
D8Ertd738e	T	A	8: 84,249,521	I33F	probably damaging	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Ddhd1	A	T	14: 45,628,821		probably benign	Het
Ddx27	A	G	2: 167,029,299	I480V	probably benign	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Dpy19l3	A	T	7: 35,703,501	M562K	probably damaging	Het
Dus3l	T	C	17: 56,767,868	L330P	probably damaging	Het
Efcab7	C	T	4: 99,831,568	Q96*	probably null	Het
Egfr	T	C	11: 16,869,231	F254L	probably damaging	Het
Entpd7	T	A	19: 43,691,195	Y62*	probably null	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Gm5528	A	G	1: 72,004,552		noncoding transcript	Het
H2-M9	G	T	17: 36,640,739	Y281*	probably null	Het
Hmcn1	T	G	1: 150,689,595	K2260N	possibly damaging	Het
Hnf4a	A	G	2: 163,564,219	I259V	probably benign	Het
Ick	A	G	9: 78,150,654	T162A	probably damaging	Het
Insm1	A	T	2: 146,222,902	T213S	probably benign	Het
Iqca	T	C	1: 90,077,822	D488G	probably damaging	Het
Kdm5a	T	A	6: 120,406,015		probably benign	Het
Kdm7a	G	C	6: 39,152,839	L468V	possibly damaging	Het
Lck	G	A	4: 129,555,984	T229I	possibly damaging	Het
Lig3	T	C	11: 82,787,727	L265P	probably damaging	Het
Lipa	T	A	19: 34,501,634	K229*	probably null	Het
Lrrk1	C	T	7: 66,306,873	S418N	probably benign	Het
Mark2	A	G	19: 7,281,232	V126A	probably damaging	Het
Met	T	C	6: 17,491,541	C101R	probably damaging	Het
Mkln1	A	T	6: 31,426,799	K85M	probably damaging	Het
Mst1	A	G	9: 108,080,521	R15G	probably benign	Het
Muc6	T	G	7: 141,640,159		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Myo7b	T	C	18: 31,998,602	S514G	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nars	T	C	18: 64,516,427	E11G	probably benign	Het
Ogdh	T	A	11: 6,297,044	F23I	probably benign	Het
Olfr1121	T	C	2: 87,372,321	I263T	probably damaging	Het
Olfr1186	C	T	2: 88,526,225	S214F	probably damaging	Het
Olfr1238	C	T	2: 89,406,486	V198I	probably benign	Het
Olfr1272	A	G	2: 90,282,381	S65P	probably damaging	Het
Olfr584	C	T	7: 103,085,914	A127V	probably damaging	Het
Olfr825	T	A	10: 130,162,838	T163S	probably benign	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Patl2	T	A	2: 122,125,306	T250S	probably damaging	Het
Pcdhac2	C	T	18: 37,145,899	T644I	possibly damaging	Het
Pi4kb	C	T	3: 95,004,338	T690I	probably damaging	Het
Pla2g4d	T	C	2: 120,266,790	Y776C	probably benign	Het
Plekhh2	C	T	17: 84,563,959	S215L	probably benign	Het
Psmd2	T	G	16: 20,659,815		probably benign	Het
Ptpn21	T	C	12: 98,708,844	E183G	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rhobtb1	T	A	10: 69,279,497		probably null	Het
Scel	T	A	14: 103,572,037	M271K	possibly damaging	Het
Senp3	A	T	11: 69,678,829	C310*	probably null	Het
Slc25a3	T	C	10: 91,122,188	T97A	possibly damaging	Het
Srsf11	A	T	3: 158,026,732	Y82*	probably null	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,648	E145G	probably damaging	Het
Tln1	T	C	4: 43,540,588	N1471S	probably benign	Het
Tnn	T	G	1: 160,146,089	D236A	probably damaging	Het
Trmt2a	C	T	16: 18,251,286		probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubxn10	G	A	4: 138,735,948		probably benign	Het
Ulk4	G	A	9: 121,073,872	Q1180*	probably null	Het
Usp43	T	A	11: 67,855,505	K1120N	probably damaging	Het
Uspl1	T	A	5: 149,194,339	L244Q	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,645	H49R	probably damaging	Het
Vmn2r4	T	C	3: 64,409,963	D118G	probably damaging	Het
Vwce	A	G	19: 10,650,579	I468V	probably benign	Het
Zbtb7c	G	T	18: 76,146,154	R561L	probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCAGAGAATCCAGAGTCTACACAG -3'
(R):5'- GCATTCCACCCACATAGAGG -3'

Sequencing Primer
(F):5'- TCCAGAGTCTACACAGATAACAATG -3'
(R):5'- CCCACATAGAGGATGACATCTGTG -3'

Posted On

2015-11-11