Incidental Mutation 'R4737:Dpp9'
ID 359375
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Name dipeptidylpeptidase 9
Synonyms DPRP2, 6430584G11Rik
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56493807-56525905 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 56505970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038794]
AlphaFold Q8BVG4
Predicted Effect probably null
Transcript: ENSMUST00000038794
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223616
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56,512,240 (GRCm39) missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56,507,599 (GRCm39) missense probably benign 0.01
IGL01568:Dpp9 APN 17 56,498,159 (GRCm39) missense probably benign
IGL01583:Dpp9 APN 17 56,518,666 (GRCm39) missense probably benign 0.00
IGL01613:Dpp9 APN 17 56,497,713 (GRCm39) missense probably benign
IGL03371:Dpp9 APN 17 56,494,377 (GRCm39) missense probably benign 0.00
R0100:Dpp9 UTSW 17 56,512,854 (GRCm39) missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56,512,854 (GRCm39) missense possibly damaging 0.75
R0418:Dpp9 UTSW 17 56,501,404 (GRCm39) splice site probably benign
R1163:Dpp9 UTSW 17 56,506,426 (GRCm39) missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56,497,103 (GRCm39) missense probably benign 0.00
R1709:Dpp9 UTSW 17 56,501,431 (GRCm39) missense probably benign
R1762:Dpp9 UTSW 17 56,495,362 (GRCm39) missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56,506,038 (GRCm39) missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56,509,885 (GRCm39) missense probably benign 0.00
R1854:Dpp9 UTSW 17 56,509,885 (GRCm39) missense probably benign 0.00
R2162:Dpp9 UTSW 17 56,506,113 (GRCm39) missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56,506,287 (GRCm39) missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56,501,973 (GRCm39) missense probably benign 0.00
R2520:Dpp9 UTSW 17 56,513,868 (GRCm39) missense probably damaging 1.00
R3831:Dpp9 UTSW 17 56,506,113 (GRCm39) missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56,506,113 (GRCm39) missense possibly damaging 0.81
R4364:Dpp9 UTSW 17 56,494,391 (GRCm39) missense possibly damaging 0.79
R4740:Dpp9 UTSW 17 56,505,970 (GRCm39) critical splice donor site probably null
R4741:Dpp9 UTSW 17 56,512,286 (GRCm39) missense probably benign
R4798:Dpp9 UTSW 17 56,498,016 (GRCm39) missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56,497,030 (GRCm39) missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56,496,424 (GRCm39) nonsense probably null
R5709:Dpp9 UTSW 17 56,496,393 (GRCm39) missense probably benign
R5783:Dpp9 UTSW 17 56,518,655 (GRCm39) missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56,513,808 (GRCm39) missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56,512,854 (GRCm39) missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56,495,321 (GRCm39) missense probably damaging 1.00
R7398:Dpp9 UTSW 17 56,496,405 (GRCm39) nonsense probably null
R7494:Dpp9 UTSW 17 56,507,619 (GRCm39) missense probably damaging 1.00
R7495:Dpp9 UTSW 17 56,502,044 (GRCm39) missense probably benign
R7511:Dpp9 UTSW 17 56,512,611 (GRCm39) missense possibly damaging 0.52
R7556:Dpp9 UTSW 17 56,497,012 (GRCm39) missense possibly damaging 0.66
R8228:Dpp9 UTSW 17 56,498,129 (GRCm39) missense probably damaging 1.00
R8481:Dpp9 UTSW 17 56,501,467 (GRCm39) missense possibly damaging 0.75
R8724:Dpp9 UTSW 17 56,512,867 (GRCm39) missense probably benign 0.03
R8798:Dpp9 UTSW 17 56,506,037 (GRCm39) missense probably damaging 1.00
R9209:Dpp9 UTSW 17 56,512,765 (GRCm39) missense probably damaging 1.00
R9660:Dpp9 UTSW 17 56,494,458 (GRCm39) missense probably damaging 1.00
R9666:Dpp9 UTSW 17 56,501,946 (GRCm39) missense probably damaging 0.99
X0065:Dpp9 UTSW 17 56,502,006 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGCCAAACTCTAATGCCCTG -3'
(R):5'- AGGTCCACGACATCTTCCAC -3'

Sequencing Primer
(F):5'- ATGCTGGAAAGTTTGCCCAC -3'
(R):5'- ACCCGTTTCCTCAGGCTGAG -3'
Posted On 2015-11-11