Mutagenetix > Incidental Mutation

Incidental Mutation 'R4737:Plekhh2'

359377

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

042024-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R4737 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84563959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 215 (S215L)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably benign
Transcript: ENSMUST00000047206
AA Change: S215L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: S215L

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Meta Mutation Damage Score

0.0725

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (94/94)

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	A	G	1: 181,227,819		noncoding transcript	Het
Acp2	A	T	2: 91,210,723	R419W	probably benign	Het
Actr5	A	G	2: 158,628,071	N207S	probably damaging	Het
Afap1	G	A	5: 35,961,782	V254M	probably benign	Het
Arfgef1	A	T	1: 10,189,611	M544K	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Bnip3l-ps	G	A	12: 18,216,772		noncoding transcript	Het
Carf	A	G	1: 60,109,318	T58A	probably benign	Het
Carns1	A	G	19: 4,170,928		probably benign	Het
Ccp110	T	A	7: 118,724,548	I670K	possibly damaging	Het
Cftr	T	A	6: 18,299,883	D1218E	probably benign	Het
Chrna9	A	T	5: 65,967,871	T52S	probably damaging	Het
Chst9	T	C	18: 15,452,777	Y243C	probably damaging	Het
Clk2	A	T	3: 89,168,709	H62L	probably benign	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Cpt1b	C	T	15: 89,421,406	D369N	probably benign	Het
Crhr2	G	T	6: 55,091,305	H423Q	probably damaging	Het
D8Ertd738e	T	A	8: 84,249,521	I33F	probably damaging	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Ddhd1	A	T	14: 45,628,821		probably benign	Het
Ddx27	A	G	2: 167,029,299	I480V	probably benign	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Dpy19l3	A	T	7: 35,703,501	M562K	probably damaging	Het
Dus3l	T	C	17: 56,767,868	L330P	probably damaging	Het
Efcab7	C	T	4: 99,831,568	Q96*	probably null	Het
Egfr	T	C	11: 16,869,231	F254L	probably damaging	Het
Eml5	C	T	12: 98,798,852	V1566M	probably damaging	Het
Entpd7	T	A	19: 43,691,195	Y62*	probably null	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Gm5528	A	G	1: 72,004,552		noncoding transcript	Het
H2-M9	G	T	17: 36,640,739	Y281*	probably null	Het
Hmcn1	T	G	1: 150,689,595	K2260N	possibly damaging	Het
Hnf4a	A	G	2: 163,564,219	I259V	probably benign	Het
Ick	A	G	9: 78,150,654	T162A	probably damaging	Het
Insm1	A	T	2: 146,222,902	T213S	probably benign	Het
Iqca	T	C	1: 90,077,822	D488G	probably damaging	Het
Kdm5a	T	A	6: 120,406,015		probably benign	Het
Kdm7a	G	C	6: 39,152,839	L468V	possibly damaging	Het
Lck	G	A	4: 129,555,984	T229I	possibly damaging	Het
Lig3	T	C	11: 82,787,727	L265P	probably damaging	Het
Lipa	T	A	19: 34,501,634	K229*	probably null	Het
Lrrk1	C	T	7: 66,306,873	S418N	probably benign	Het
Mark2	A	G	19: 7,281,232	V126A	probably damaging	Het
Met	T	C	6: 17,491,541	C101R	probably damaging	Het
Mkln1	A	T	6: 31,426,799	K85M	probably damaging	Het
Mst1	A	G	9: 108,080,521	R15G	probably benign	Het
Muc6	T	G	7: 141,640,159		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Myo7b	T	C	18: 31,998,602	S514G	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nars	T	C	18: 64,516,427	E11G	probably benign	Het
Ogdh	T	A	11: 6,297,044	F23I	probably benign	Het
Olfr1121	T	C	2: 87,372,321	I263T	probably damaging	Het
Olfr1186	C	T	2: 88,526,225	S214F	probably damaging	Het
Olfr1238	C	T	2: 89,406,486	V198I	probably benign	Het
Olfr1272	A	G	2: 90,282,381	S65P	probably damaging	Het
Olfr584	C	T	7: 103,085,914	A127V	probably damaging	Het
Olfr825	T	A	10: 130,162,838	T163S	probably benign	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Patl2	T	A	2: 122,125,306	T250S	probably damaging	Het
Pcdhac2	C	T	18: 37,145,899	T644I	possibly damaging	Het
Pi4kb	C	T	3: 95,004,338	T690I	probably damaging	Het
Pla2g4d	T	C	2: 120,266,790	Y776C	probably benign	Het
Psmd2	T	G	16: 20,659,815		probably benign	Het
Ptpn21	T	C	12: 98,708,844	E183G	probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rhobtb1	T	A	10: 69,279,497		probably null	Het
Scel	T	A	14: 103,572,037	M271K	possibly damaging	Het
Senp3	A	T	11: 69,678,829	C310*	probably null	Het
Slc25a3	T	C	10: 91,122,188	T97A	possibly damaging	Het
Srsf11	A	T	3: 158,026,732	Y82*	probably null	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,648	E145G	probably damaging	Het
Tln1	T	C	4: 43,540,588	N1471S	probably benign	Het
Tnn	T	G	1: 160,146,089	D236A	probably damaging	Het
Trmt2a	C	T	16: 18,251,286		probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubxn10	G	A	4: 138,735,948		probably benign	Het
Ulk4	G	A	9: 121,073,872	Q1180*	probably null	Het
Usp43	T	A	11: 67,855,505	K1120N	probably damaging	Het
Uspl1	T	A	5: 149,194,339	L244Q	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,645	H49R	probably damaging	Het
Vmn2r4	T	C	3: 64,409,963	D118G	probably damaging	Het
Vwce	A	G	19: 10,650,579	I468V	probably benign	Het
Zbtb7c	G	T	18: 76,146,154	R561L	probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GTTCTGTGCTCTATATCAGGCC -3'
(R):5'- ACCAGCAGGCAAACTTTAGAGG -3'

Sequencing Primer
(F):5'- AAGAGCAAATTCTGTCTTTCTGG -3'
(R):5'- CAGGCAAACTTTAGAGGGAGACTG -3'

Posted On

2015-11-11