Incidental Mutation 'R4737:Pcdhac2'
ID 359380
Institutional Source Beutler Lab
Gene Symbol Pcdhac2
Ensembl Gene ENSMUSG00000102697
Gene Name protocadherin alpha subfamily C, 2
Synonyms CNRc2
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37276731-37320716 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37278952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 644 (T644I)
Ref Sequence ENSEMBL: ENSMUSP00000039888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007584] [ENSMUST00000047479] [ENSMUST00000047614] [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590] [ENSMUST00000194038] [ENSMUST00000192168] [ENSMUST00000193389] [ENSMUST00000192631] [ENSMUST00000192295] [ENSMUST00000193839] [ENSMUST00000192512] [ENSMUST00000193777] [ENSMUST00000192447] [ENSMUST00000192503]
AlphaFold Q91Y09
Predicted Effect probably benign
Transcript: ENSMUST00000007584
SMART Domains Protein: ENSMUSP00000007584
Gene: ENSMUSG00000103255

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 45 122 3.59e-1 SMART
CA 146 231 6.32e-22 SMART
CA 255 338 5.18e-18 SMART
CA 362 443 9.73e-23 SMART
CA 467 554 4.24e-23 SMART
CA 584 662 1.11e-8 SMART
Pfam:Cadherin_C_2 682 773 1.1e-12 PFAM
Pfam:Cadherin_tail 813 947 5.4e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000047479
AA Change: T644I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039888
Gene: ENSMUSG00000102697
AA Change: T644I

DomainStartEndE-ValueType
CA 30 145 9.8e-3 SMART
CA 169 254 2.07e-17 SMART
CA 278 362 2.86e-29 SMART
CA 386 466 4.79e-22 SMART
CA 490 576 1.44e-25 SMART
CA 606 687 3.45e-14 SMART
Pfam:Cadherin_C_2 702 809 1.2e-26 PFAM
low complexity region 810 823 N/A INTRINSIC
Pfam:Cadherin_tail 855 989 5.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047614
SMART Domains Protein: ENSMUSP00000047609
Gene: ENSMUSG00000103310

DomainStartEndE-ValueType
CA 19 131 3.78e-2 SMART
CA 155 240 3.26e-24 SMART
CA 264 348 6.37e-27 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 6.18e-25 SMART
CA 594 676 5.6e-14 SMART
low complexity region 679 696 N/A INTRINSIC
transmembrane domain 699 721 N/A INTRINSIC
Pfam:Cadherin_tail 799 933 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Meta Mutation Damage Score 0.2119 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile with no apparent gross phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Pcdhac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pcdhac2 APN 18 37,278,128 (GRCm39) missense probably damaging 1.00
IGL01400:Pcdhac2 APN 18 37,279,339 (GRCm39) missense possibly damaging 0.79
IGL02302:Pcdhac2 APN 18 37,279,006 (GRCm39) missense probably damaging 0.99
IGL02381:Pcdhac2 APN 18 37,277,320 (GRCm39) missense possibly damaging 0.94
IGL02644:Pcdhac2 APN 18 37,278,232 (GRCm39) missense probably benign
IGL02645:Pcdhac2 APN 18 37,278,292 (GRCm39) missense probably damaging 0.97
IGL03087:Pcdhac2 APN 18 37,278,735 (GRCm39) missense probably damaging 1.00
R0004:Pcdhac2 UTSW 18 37,278,290 (GRCm39) missense probably benign 0.21
R0374:Pcdhac2 UTSW 18 37,278,720 (GRCm39) missense probably damaging 1.00
R0540:Pcdhac2 UTSW 18 37,278,942 (GRCm39) missense probably benign 0.02
R0589:Pcdhac2 UTSW 18 37,279,527 (GRCm39) missense probably benign
R0607:Pcdhac2 UTSW 18 37,278,942 (GRCm39) missense probably benign 0.02
R1537:Pcdhac2 UTSW 18 37,279,539 (GRCm39) missense possibly damaging 0.51
R1545:Pcdhac2 UTSW 18 37,279,186 (GRCm39) missense possibly damaging 0.93
R1878:Pcdhac2 UTSW 18 37,278,215 (GRCm39) missense possibly damaging 0.71
R2139:Pcdhac2 UTSW 18 37,279,139 (GRCm39) nonsense probably null
R2197:Pcdhac2 UTSW 18 37,279,185 (GRCm39) missense probably damaging 0.99
R2680:Pcdhac2 UTSW 18 37,278,639 (GRCm39) missense possibly damaging 0.82
R2882:Pcdhac2 UTSW 18 37,278,865 (GRCm39) missense probably damaging 1.00
R3719:Pcdhac2 UTSW 18 37,279,288 (GRCm39) missense possibly damaging 0.59
R4256:Pcdhac2 UTSW 18 37,277,764 (GRCm39) missense probably damaging 1.00
R4407:Pcdhac2 UTSW 18 37,277,499 (GRCm39) missense probably benign 0.00
R4426:Pcdhac2 UTSW 18 37,277,796 (GRCm39) missense probably benign 0.00
R4698:Pcdhac2 UTSW 18 37,278,822 (GRCm39) missense probably damaging 1.00
R4950:Pcdhac2 UTSW 18 37,278,283 (GRCm39) missense probably benign 0.06
R4993:Pcdhac2 UTSW 18 37,279,304 (GRCm39) missense probably damaging 0.96
R5127:Pcdhac2 UTSW 18 37,277,352 (GRCm39) nonsense probably null
R5446:Pcdhac2 UTSW 18 37,278,253 (GRCm39) missense probably damaging 1.00
R5598:Pcdhac2 UTSW 18 37,277,476 (GRCm39) missense probably damaging 1.00
R5615:Pcdhac2 UTSW 18 37,279,476 (GRCm39) missense probably benign 0.22
R5615:Pcdhac2 UTSW 18 37,279,477 (GRCm39) missense probably benign
R5620:Pcdhac2 UTSW 18 37,277,257 (GRCm39) missense probably benign
R5661:Pcdhac2 UTSW 18 37,278,499 (GRCm39) missense probably damaging 0.97
R5760:Pcdhac2 UTSW 18 37,279,453 (GRCm39) missense probably damaging 1.00
R6102:Pcdhac2 UTSW 18 37,279,335 (GRCm39) nonsense probably null
R6310:Pcdhac2 UTSW 18 37,278,824 (GRCm39) nonsense probably null
R6493:Pcdhac2 UTSW 18 37,277,758 (GRCm39) missense probably damaging 1.00
R6695:Pcdhac2 UTSW 18 37,278,256 (GRCm39) missense probably benign 0.00
R6827:Pcdhac2 UTSW 18 37,277,706 (GRCm39) missense probably benign 0.03
R6953:Pcdhac2 UTSW 18 37,277,479 (GRCm39) missense probably benign
R7140:Pcdhac2 UTSW 18 37,277,239 (GRCm39) missense possibly damaging 0.89
R7162:Pcdhac2 UTSW 18 37,278,840 (GRCm39) missense probably benign 0.13
R7242:Pcdhac2 UTSW 18 37,277,946 (GRCm39) missense possibly damaging 0.82
R7325:Pcdhac2 UTSW 18 37,278,413 (GRCm39) missense probably damaging 1.00
R7640:Pcdhac2 UTSW 18 37,277,578 (GRCm39) missense probably damaging 1.00
R7654:Pcdhac2 UTSW 18 37,278,076 (GRCm39) missense probably damaging 1.00
R7810:Pcdhac2 UTSW 18 37,278,717 (GRCm39) missense probably benign 0.18
R8072:Pcdhac2 UTSW 18 37,278,717 (GRCm39) missense probably benign 0.18
R8079:Pcdhac2 UTSW 18 37,279,197 (GRCm39) missense probably damaging 0.96
R8272:Pcdhac2 UTSW 18 37,279,242 (GRCm39) missense probably benign 0.30
R8489:Pcdhac2 UTSW 18 37,278,207 (GRCm39) missense probably damaging 1.00
R8893:Pcdhac2 UTSW 18 37,277,071 (GRCm39) missense probably benign
R9035:Pcdhac2 UTSW 18 37,277,758 (GRCm39) missense probably damaging 1.00
R9189:Pcdhac2 UTSW 18 37,277,316 (GRCm39) missense probably benign 0.00
R9262:Pcdhac2 UTSW 18 37,279,095 (GRCm39) missense possibly damaging 0.71
R9626:Pcdhac2 UTSW 18 37,279,555 (GRCm39) missense probably damaging 0.99
R9688:Pcdhac2 UTSW 18 37,277,628 (GRCm39) missense probably benign 0.01
T0970:Pcdhac2 UTSW 18 37,278,388 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATGTGGTGGACGTGAATGACC -3'
(R):5'- TGATCTCAGAGTATGTCCGAGGAC -3'

Sequencing Primer
(F):5'- TCAACTAATACATCAGCAGCCATTG -3'
(R):5'- CCGAGGACTCTTTATATGTCTCTGAG -3'
Posted On 2015-11-11