Incidental Mutation 'R0332:Fam228a'
ID 35939
Institutional Source Beutler Lab
Gene Symbol Fam228a
Ensembl Gene ENSMUSG00000079177
Gene Name family with sequence similarity 228, member A
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R0332 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 4713670-4738430 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4735018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 38 (I38F)
Ref Sequence ENSEMBL: ENSMUSP00000152506 (fasta)
AlphaFold Q8CDW1
Predicted Effect probably damaging
Transcript: ENSMUST00000111154
AA Change: I38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218905
Predicted Effect probably benign
Transcript: ENSMUST00000219898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220075
Predicted Effect probably damaging
Transcript: ENSMUST00000220978
AA Change: I38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222363
AA Change: I38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Fam228a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Fam228a APN 12 4732773 missense possibly damaging 0.94
IGL01472:Fam228a APN 12 4715610 missense possibly damaging 0.64
IGL02602:Fam228a APN 12 4732808 missense probably benign 0.00
IGL02797:Fam228a APN 12 4731484 missense probably damaging 1.00
IGL03247:Fam228a APN 12 4737734 missense probably damaging 1.00
R0437:Fam228a UTSW 12 4732759 missense probably damaging 1.00
R0454:Fam228a UTSW 12 4731457 missense probably damaging 1.00
R0838:Fam228a UTSW 12 4735002 missense possibly damaging 0.92
R1791:Fam228a UTSW 12 4732748 missense probably damaging 1.00
R1836:Fam228a UTSW 12 4715620 missense probably damaging 1.00
R2256:Fam228a UTSW 12 4737775 start gained probably benign
R2257:Fam228a UTSW 12 4737775 start gained probably benign
R2397:Fam228a UTSW 12 4718718 missense probably benign 0.22
R3731:Fam228a UTSW 12 4718671 missense probably benign 0.44
R3921:Fam228a UTSW 12 4731506 missense probably benign 0.02
R5937:Fam228a UTSW 12 4737725 missense probably damaging 1.00
R7278:Fam228a UTSW 12 4732790 missense probably benign 0.01
R7610:Fam228a UTSW 12 4731423 critical splice donor site probably null
R9134:Fam228a UTSW 12 4715686 missense probably benign 0.27
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggtggagggcagaaaatgag -3'
Posted On 2013-05-09