Incidental Mutation 'R4738:Ptprj'
ID359403
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Nameprotein tyrosine phosphatase, receptor type, J
SynonymsCD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90429754-90580647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90440643 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1247 (P1247L)
Ref Sequence ENSEMBL: ENSMUSP00000129592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]
Predicted Effect probably damaging
Transcript: ENSMUST00000111493
AA Change: P1061L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: P1061L

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
FN3 47 182 3.76e-6 SMART
FN3 194 271 4.56e-5 SMART
FN3 282 357 5.32e-6 SMART
FN3 368 446 2.19e-7 SMART
FN3 455 531 5e-2 SMART
FN3 546 628 2.77e1 SMART
low complexity region 637 650 N/A INTRINSIC
Blast:PTPc 714 797 8e-26 BLAST
PTPc 867 1127 3.37e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111495
AA Change: P1154L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: P1154L

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
FN3 59 131 2.85e-6 SMART
FN3 140 275 3.76e-6 SMART
FN3 287 364 4.56e-5 SMART
FN3 375 450 5.32e-6 SMART
FN3 461 539 2.19e-7 SMART
FN3 548 624 5e-2 SMART
FN3 639 721 2.77e1 SMART
low complexity region 730 743 N/A INTRINSIC
Blast:PTPc 807 890 1e-25 BLAST
PTPc 960 1220 3.37e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168621
AA Change: P1247L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: P1247L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90452144 missense probably damaging 1.00
IGL01594:Ptprj APN 2 90440795 splice site probably benign
IGL01767:Ptprj APN 2 90469574 missense probably benign 0.11
IGL01917:Ptprj APN 2 90469749 missense probably damaging 1.00
IGL01981:Ptprj APN 2 90439912 missense probably damaging 1.00
IGL02830:Ptprj APN 2 90453144 missense probably benign 0.22
IGL02955:Ptprj APN 2 90468464 critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90478968 missense probably benign 0.02
IGL03150:Ptprj APN 2 90460611 missense probably damaging 0.98
IGL03210:Ptprj APN 2 90469726 missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90469598 missense probably benign 0.00
R0083:Ptprj UTSW 2 90469777 intron probably null
R0108:Ptprj UTSW 2 90469777 intron probably null
R0579:Ptprj UTSW 2 90436569 critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90453421 missense probably damaging 1.00
R1160:Ptprj UTSW 2 90444524 missense probably damaging 1.00
R1238:Ptprj UTSW 2 90444414 splice site probably null
R1507:Ptprj UTSW 2 90471287 missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90471153 missense probably damaging 0.98
R1607:Ptprj UTSW 2 90463320 missense probably benign 0.14
R1693:Ptprj UTSW 2 90449797 nonsense probably null
R2016:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2017:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2044:Ptprj UTSW 2 90463095 missense probably damaging 0.96
R2322:Ptprj UTSW 2 90471129 missense probably benign 0.06
R2516:Ptprj UTSW 2 90474996 splice site probably benign
R3106:Ptprj UTSW 2 90440631 missense probably damaging 1.00
R3964:Ptprj UTSW 2 90468441 missense probably benign 0.00
R4201:Ptprj UTSW 2 90463095 missense probably damaging 0.99
R4533:Ptprj UTSW 2 90439955 missense probably damaging 1.00
R4680:Ptprj UTSW 2 90460496 missense probably benign 0.00
R4983:Ptprj UTSW 2 90460532 missense probably damaging 0.98
R5137:Ptprj UTSW 2 90469648 missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90471261 missense probably benign 0.00
R5369:Ptprj UTSW 2 90469641 missense probably benign 0.09
R5718:Ptprj UTSW 2 90458269 missense probably benign 0.00
R5914:Ptprj UTSW 2 90453340 missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90471323 missense probably benign 0.14
R6341:Ptprj UTSW 2 90458349 missense probably benign
R6421:Ptprj UTSW 2 90471140 missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90450851 missense probably benign 0.04
R6831:Ptprj UTSW 2 90460647 missense probably damaging 1.00
R6939:Ptprj UTSW 2 90459514 missense possibly damaging 0.68
R6972:Ptprj UTSW 2 90580403 missense possibly damaging 0.91
R7134:Ptprj UTSW 2 90464478 missense probably benign 0.16
R7149:Ptprj UTSW 2 90444446 missense possibly damaging 0.95
R7243:Ptprj UTSW 2 90446421 missense probably damaging 0.96
R7335:Ptprj UTSW 2 90440782 missense probably benign 0.01
R7439:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90436565 nonsense probably null
R7571:Ptprj UTSW 2 90455186 missense probably benign 0.24
R7672:Ptprj UTSW 2 90460596 missense possibly damaging 0.49
R7849:Ptprj UTSW 2 90444460 missense probably damaging 0.98
R7932:Ptprj UTSW 2 90444460 missense probably damaging 0.98
RF013:Ptprj UTSW 2 90471170 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCCTTTCTATAGTCTCAGGGAC -3'
(R):5'- AGGCCTGCTTGATTTCACTC -3'

Sequencing Primer
(F):5'- TCTCAGGGACTAAGGCCACAG -3'
(R):5'- CACCGTTGTGATACTGTCAGGTATC -3'
Posted On2015-11-11