Incidental Mutation 'R4738:Depdc5'
ID359416
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32975322 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1237 (M1237V)
Ref Sequence ENSEMBL: ENSMUSP00000113980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780]
Predicted Effect probably benign
Transcript: ENSMUST00000087897
AA Change: M1268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: M1268V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119705
AA Change: M1259V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: M1259V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
AA Change: M1237V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: M1237V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000124780
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127560
Predicted Effect unknown
Transcript: ENSMUST00000137169
AA Change: M643V
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: M643V

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCAGTATTGAACAACCACTACTTC -3'
(R):5'- CTGCTTGCATAAGAGGCTGG -3'

Sequencing Primer
(F):5'- CTCACTGTGTAAGCACTAGTAGC -3'
(R):5'- ATAAGAGGCTGGCCGGC -3'
Posted On2015-11-11