Incidental Mutation 'R4738:Depdc5'
ID 359416
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 041964-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4738 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33132666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1237 (M1237V)
Ref Sequence ENSEMBL: ENSMUSP00000113980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780]
AlphaFold P61460
Predicted Effect probably benign
Transcript: ENSMUST00000087897
AA Change: M1268V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: M1268V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119705
AA Change: M1259V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: M1259V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
AA Change: M1237V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: M1237V

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000124780
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127560
Predicted Effect unknown
Transcript: ENSMUST00000137169
AA Change: M643V
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: M643V

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,121,849 (GRCm39) I176T probably benign Het
Abtb3 C T 10: 85,463,112 (GRCm39) Q626* probably null Het
Angpt2 C T 8: 18,791,075 (GRCm39) D74N probably benign Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Areg T C 5: 91,294,583 (GRCm39) I247T possibly damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Atp6v1b2 T A 8: 69,556,062 (GRCm39) S246T probably benign Het
Atp8b1 T C 18: 64,678,251 (GRCm39) R882G probably benign Het
Atp9a A G 2: 168,510,101 (GRCm39) V444A probably benign Het
Babam2 T A 5: 32,058,486 (GRCm39) Y211N probably damaging Het
Ccdc127 T G 13: 74,505,187 (GRCm39) probably benign Het
Cep192 A T 18: 68,017,901 (GRCm39) K2500* probably null Het
Cnot4 T C 6: 35,028,311 (GRCm39) N435S probably benign Het
Col12a1 T C 9: 79,606,564 (GRCm39) I620V probably damaging Het
Cyth4 G A 15: 78,490,074 (GRCm39) M62I probably benign Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Dchs1 C T 7: 105,407,880 (GRCm39) R1984Q probably damaging Het
Disp2 A G 2: 118,620,807 (GRCm39) Y513C probably damaging Het
Dph7 T C 2: 24,853,143 (GRCm39) S86P possibly damaging Het
Eif3b T A 5: 140,415,833 (GRCm39) M384K probably benign Het
Emc1 G T 4: 139,089,513 (GRCm39) G227V possibly damaging Het
Eri2 A G 7: 119,386,955 (GRCm39) probably null Het
Frzb A G 2: 80,254,941 (GRCm39) probably null Het
Ganc T A 2: 120,283,075 (GRCm39) V743D probably damaging Het
Gfpt1 C A 6: 87,031,729 (GRCm39) probably benign Het
Gm3086 A T 12: 70,016,155 (GRCm39) probably benign Het
Gsdmc2 A T 15: 63,698,650 (GRCm39) Y315* probably null Het
Haus6 A G 4: 86,518,986 (GRCm39) probably null Het
Hhip C T 8: 80,719,199 (GRCm39) D443N probably damaging Het
Isg15 T C 4: 156,284,319 (GRCm39) M70V probably benign Het
Kank2 T C 9: 21,685,915 (GRCm39) N653S probably damaging Het
Klhdc1 G T 12: 69,329,907 (GRCm39) R345S probably benign Het
Larp7 A G 3: 127,339,694 (GRCm39) probably null Het
Lgals12 A G 19: 7,581,464 (GRCm39) V81A probably benign Het
Lhx9 A G 1: 138,760,486 (GRCm39) L288P probably damaging Het
Mcpt9 T A 14: 56,264,456 (GRCm39) H213L probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Neb A C 2: 52,077,494 (GRCm39) S1846A probably damaging Het
Nr3c2 T C 8: 77,635,936 (GRCm39) S346P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or10h5 A G 17: 33,434,784 (GRCm39) F178S probably benign Het
Or1e1c G T 11: 73,266,176 (GRCm39) L200F possibly damaging Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or5h19 T C 16: 58,856,558 (GRCm39) I181V probably benign Het
Or5p63 A T 7: 107,811,201 (GRCm39) N178K probably damaging Het
Osbpl10 A G 9: 115,045,642 (GRCm39) E426G probably damaging Het
Ovgp1 T C 3: 105,887,234 (GRCm39) V210A probably damaging Het
Pam A T 1: 97,850,857 (GRCm39) V167D probably damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pbx4 C T 8: 70,317,619 (GRCm39) T201M probably damaging Het
Pcdhb9 T C 18: 37,536,468 (GRCm39) C821R probably benign Het
Plekhg3 T C 12: 76,623,688 (GRCm39) I976T probably damaging Het
Pold1 G A 7: 44,190,753 (GRCm39) R304C probably damaging Het
Prss38 T C 11: 59,263,771 (GRCm39) T314A probably benign Het
Psph T C 5: 129,846,450 (GRCm39) probably null Het
Ptprj G A 2: 90,270,987 (GRCm39) P1247L probably damaging Het
Rab3gap1 A G 1: 127,862,173 (GRCm39) E648G probably damaging Het
Ralgds A G 2: 28,435,428 (GRCm39) E465G probably damaging Het
Rfng T C 11: 120,674,790 (GRCm39) T67A probably damaging Het
Rps6kl1 G T 12: 85,187,161 (GRCm39) F181L probably benign Het
Spata46 G A 1: 170,139,455 (GRCm39) M151I possibly damaging Het
Ssbp1 T A 6: 40,454,914 (GRCm39) N124K probably damaging Het
Sspo C T 6: 48,455,330 (GRCm39) A3064V possibly damaging Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tdpoz4 T C 3: 93,704,396 (GRCm39) I231T probably damaging Het
Tff3 G A 17: 31,346,483 (GRCm39) P30S probably benign Het
Thg1l C T 11: 45,845,018 (GRCm39) R18Q probably damaging Het
Tlk2 T A 11: 105,147,708 (GRCm39) H369Q probably benign Het
Tnfaip8 A G 18: 50,223,569 (GRCm39) T14A probably damaging Het
Tspan17 T A 13: 54,942,877 (GRCm39) C116* probably null Het
Ttn T C 2: 76,710,890 (GRCm39) probably benign Het
Tyr T C 7: 87,141,855 (GRCm39) Y158C probably null Het
U2af1l4 G T 7: 30,262,773 (GRCm39) probably benign Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Vmn2r86 T A 10: 130,282,939 (GRCm39) D559V probably damaging Het
Wfikkn2 T A 11: 94,129,902 (GRCm39) T80S probably benign Het
Zdhhc2 T A 8: 40,917,183 (GRCm39) probably null Het
Zfp521 T C 18: 13,977,111 (GRCm39) K1101E possibly damaging Het
Zfp595 A T 13: 67,465,229 (GRCm39) F345I probably benign Het
Zswim2 T A 2: 83,745,739 (GRCm39) R566S probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCAGTATTGAACAACCACTACTTC -3'
(R):5'- CTGCTTGCATAAGAGGCTGG -3'

Sequencing Primer
(F):5'- CTCACTGTGTAAGCACTAGTAGC -3'
(R):5'- ATAAGAGGCTGGCCGGC -3'
Posted On 2015-11-11