Mutagenetix > Incidental Mutations

Incidental Mutation 'R4738:Nr3c2'

359439

Institutional Source

Beutler Lab

Gene Symbol

Nr3c2

Ensembl Gene

ENSMUSG00000031618

Gene Name

nuclear receptor subfamily 3, group C, member 2

Synonyms

MR, aldosterone receptor, mineralocorticoid receptor, Mlr

MMRRC Submission

041964-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4738 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76899442-77245012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76909307 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 346 (S346P)

Ref Sequence

ENSEMBL: ENSMUSP00000105539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034031
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: S346P

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	675	1.89e-31	SMART
low complexity region	690	706	N/A	INTRINSIC
HOLI	771	935	7.78e-33	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109911
AA Change: S346P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: S346P

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
HOLI	658	818	1.1e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109912
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: S346P

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109913
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: S346P

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128862

Predicted Effect

probably benign
Transcript: ENSMUST00000143284

Predicted Effect

probably benign
Transcript: ENSMUST00000148106
AA Change: S346P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: S346P

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,973,983	I176T	probably benign	Het
Angpt2	C	T	8: 18,741,059	D74N	probably benign	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Areg	T	C	5: 91,146,724	I247T	possibly damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Atp6v1b2	T	A	8: 69,103,410	S246T	probably benign	Het
Atp8b1	T	C	18: 64,545,180	R882G	probably benign	Het
Atp9a	A	G	2: 168,668,181	V444A	probably benign	Het
Babam2	T	A	5: 31,901,142	Y211N	probably damaging	Het
Btbd11	C	T	10: 85,627,248	Q626*	probably null	Het
Ccdc127	T	G	13: 74,357,068		probably benign	Het
Cep192	A	T	18: 67,884,830	K2500*	probably null	Het
Cnot4	T	C	6: 35,051,376	N435S	probably benign	Het
Col12a1	T	C	9: 79,699,282	I620V	probably damaging	Het
Cyth4	G	A	15: 78,605,874	M62I	probably benign	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Dchs1	C	T	7: 105,758,673	R1984Q	probably damaging	Het
Depdc5	A	G	5: 32,975,322	M1237V	probably benign	Het
Disp2	A	G	2: 118,790,326	Y513C	probably damaging	Het
Dph7	T	C	2: 24,963,131	S86P	possibly damaging	Het
Eif3b	T	A	5: 140,430,078	M384K	probably benign	Het
Emc1	G	T	4: 139,362,202	G227V	possibly damaging	Het
Eri2	A	G	7: 119,787,732		probably null	Het
Frzb	A	G	2: 80,424,597		probably null	Het
Ganc	T	A	2: 120,452,594	V743D	probably damaging	Het
Gfpt1	C	A	6: 87,054,747		probably benign	Het
Gm3086	A	T	12: 69,969,381		probably benign	Het
Gsdmc2	A	T	15: 63,826,801	Y315*	probably null	Het
Haus6	A	G	4: 86,600,749		probably null	Het
Hhip	C	T	8: 79,992,570	D443N	probably damaging	Het
Isg15	T	C	4: 156,199,862	M70V	probably benign	Het
Kank2	T	C	9: 21,774,619	N653S	probably damaging	Het
Klhdc1	G	T	12: 69,283,133	R345S	probably benign	Het
Larp7	A	G	3: 127,546,045		probably null	Het
Lgals12	A	G	19: 7,604,099	V81A	probably benign	Het
Lhx9	A	G	1: 138,832,748	L288P	probably damaging	Het
Mcpt9	T	A	14: 56,026,999	H213L	probably damaging	Het
Met	T	C	6: 17,491,541	C101R	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Neb	A	C	2: 52,187,482	S1846A	probably damaging	Het
Olfr1564	A	G	17: 33,215,810	F178S	probably benign	Het
Olfr187	T	C	16: 59,036,195	I181V	probably benign	Het
Olfr376	G	T	11: 73,375,350	L200F	possibly damaging	Het
Olfr487	A	T	7: 108,211,994	N178K	probably damaging	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Osbpl10	A	G	9: 115,216,574	E426G	probably damaging	Het
Ovgp1	T	C	3: 105,979,918	V210A	probably damaging	Het
Pam	A	T	1: 97,923,132	V167D	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pbx4	C	T	8: 69,864,969	T201M	probably damaging	Het
Pcdhb9	T	C	18: 37,403,415	C821R	probably benign	Het
Plekhg3	T	C	12: 76,576,914	I976T	probably damaging	Het
Pold1	G	A	7: 44,541,329	R304C	probably damaging	Het
Prss38	T	C	11: 59,372,945	T314A	probably benign	Het
Psph	T	C	5: 129,769,386		probably null	Het
Ptprj	G	A	2: 90,440,643	P1247L	probably damaging	Het
Rab3gap1	A	G	1: 127,934,436	E648G	probably damaging	Het
Ralgds	A	G	2: 28,545,416	E465G	probably damaging	Het
Rfng	T	C	11: 120,783,964	T67A	probably damaging	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Rps6kl1	G	T	12: 85,140,387	F181L	probably benign	Het
Spata46	G	A	1: 170,311,886	M151I	possibly damaging	Het
Ssbp1	T	A	6: 40,477,980	N124K	probably damaging	Het
Sspo	C	T	6: 48,478,396	A3064V	possibly damaging	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tdpoz4	T	C	3: 93,797,089	I231T	probably damaging	Het
Tff3	G	A	17: 31,127,509	P30S	probably benign	Het
Thg1l	C	T	11: 45,954,191	R18Q	probably damaging	Het
Tlk2	T	A	11: 105,256,882	H369Q	probably benign	Het
Tnfaip8	A	G	18: 50,090,502	T14A	probably damaging	Het
Tspan17	T	A	13: 54,795,064	C116*	probably null	Het
Ttn	T	C	2: 76,880,546		probably benign	Het
Tyr	T	C	7: 87,492,647	Y158C	probably null	Het
U2af1l4	G	T	7: 30,563,348		probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Vmn2r86	T	A	10: 130,447,070	D559V	probably damaging	Het
Wfikkn2	T	A	11: 94,239,076	T80S	probably benign	Het
Zdhhc2	T	A	8: 40,464,142		probably null	Het
Zfp521	T	C	18: 13,844,054	K1101E	possibly damaging	Het
Zfp595	A	T	13: 67,317,165	F345I	probably benign	Het
Zswim2	T	A	2: 83,915,395	R566S	probably benign	Het

Other mutations in Nr3c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00691:Nr3c2	APN	8	76909590	missense	possibly damaging	0.82
IGL01019:Nr3c2	APN	8	76909214	missense	probably damaging	0.99
IGL01085:Nr3c2	APN	8	76908354	missense	probably benign	0.02
IGL01395:Nr3c2	APN	8	76908848	missense	possibly damaging	0.73
IGL01505:Nr3c2	APN	8	76909187	missense	probably damaging	1.00
IGL01656:Nr3c2	APN	8	77187537	missense	probably damaging	1.00
IGL01802:Nr3c2	APN	8	76908595	nonsense	probably null
IGL02147:Nr3c2	APN	8	76909067	missense	probably damaging	0.98
IGL02502:Nr3c2	APN	8	77242514	missense	probably damaging	1.00
IGL02706:Nr3c2	APN	8	76908416	splice site	probably null
IGL02945:Nr3c2	APN	8	76909659	missense	probably damaging	1.00
IGL03034:Nr3c2	APN	8	77187638	nonsense	probably null
IGL03162:Nr3c2	APN	8	77217584	missense	probably damaging	0.99
naughty	UTSW	8	76908668	splice site	probably null
R0141:Nr3c2	UTSW	8	76908408	missense	probably damaging	0.99
R0422:Nr3c2	UTSW	8	77185967	missense	probably benign
R0458:Nr3c2	UTSW	8	76909538	missense	probably damaging	1.00
R0595:Nr3c2	UTSW	8	76909604	missense	possibly damaging	0.93
R0615:Nr3c2	UTSW	8	77185889	missense	probably benign	0.05
R0964:Nr3c2	UTSW	8	76908668	splice site	probably null
R0989:Nr3c2	UTSW	8	77187564	missense	probably damaging	0.97
R1532:Nr3c2	UTSW	8	76909104	missense	probably damaging	0.99
R1624:Nr3c2	UTSW	8	76909944	missense	probably damaging	1.00
R1737:Nr3c2	UTSW	8	76908329	missense	probably benign	0.16
R1965:Nr3c2	UTSW	8	76909463	missense	probably damaging	0.99
R2011:Nr3c2	UTSW	8	76909793	missense	possibly damaging	0.53
R2110:Nr3c2	UTSW	8	76908527	missense	possibly damaging	0.75
R2281:Nr3c2	UTSW	8	76909907	missense	probably damaging	0.99
R3782:Nr3c2	UTSW	8	77085684	splice site	probably null
R3808:Nr3c2	UTSW	8	76908714	missense	probably damaging	1.00
R4133:Nr3c2	UTSW	8	76909749	missense	probably damaging	1.00
R4433:Nr3c2	UTSW	8	77217467	missense	probably damaging	1.00
R4770:Nr3c2	UTSW	8	76908243	splice site	probably null
R4884:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R5169:Nr3c2	UTSW	8	76909037	missense	probably damaging	1.00
R5347:Nr3c2	UTSW	8	77210748	missense	possibly damaging	0.92
R5857:Nr3c2	UTSW	8	76908867	missense	possibly damaging	0.53
R5878:Nr3c2	UTSW	8	76908268	critical splice acceptor site	probably null
R6262:Nr3c2	UTSW	8	76908633	missense	possibly damaging	0.65
R6547:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R6820:Nr3c2	UTSW	8	77242457	missense	probably damaging	0.98
R7180:Nr3c2	UTSW	8	76908963	missense	probably damaging	0.99
R7672:Nr3c2	UTSW	8	76909209	missense	probably damaging	1.00
R7741:Nr3c2	UTSW	8	77210646	missense	probably damaging	0.97
R7776:Nr3c2	UTSW	8	76909545	missense	possibly damaging	0.77
R7800:Nr3c2	UTSW	8	76909992	missense	probably damaging	1.00
Z1088:Nr3c2	UTSW	8	76908632	missense	possibly damaging	0.48
Z1176:Nr3c2	UTSW	8	76909700	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCAAGTCACTGCAGTGTAAAATC -3'
(R):5'- ACTGCTGAAAGCCCCATCTG -3'

Sequencing Primer
(F):5'- GTCACTGCAGTGTAAAATCTCCAG -3'
(R):5'- TGAAAGCCCCATCTGGTTCTGG -3'

Posted On

2015-11-11