Incidental Mutation 'R4738:Nr3c2'
ID359439
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76909307 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 346 (S346P)
Ref Sequence ENSEMBL: ENSMUSP00000105539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034031
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109911
AA Change: S346P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109912
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109913
AA Change: S346P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128862
Predicted Effect probably benign
Transcript: ENSMUST00000143284
Predicted Effect probably benign
Transcript: ENSMUST00000148106
AA Change: S346P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: S346P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Z1176:Nr3c2 UTSW 8 76909700 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAAGTCACTGCAGTGTAAAATC -3'
(R):5'- ACTGCTGAAAGCCCCATCTG -3'

Sequencing Primer
(F):5'- GTCACTGCAGTGTAAAATCTCCAG -3'
(R):5'- TGAAAGCCCCATCTGGTTCTGG -3'
Posted On2015-11-11