Incidental Mutation 'R4738:Hhip'
ID359440
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene NameHedgehog-interacting protein
SynonymsHip, Hhip1, Hip1
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79965851-80058006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79992570 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 443 (D443N)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
Predicted Effect probably damaging
Transcript: ENSMUST00000079038
AA Change: D443N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: D443N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155850
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 79996783 missense probably damaging 0.96
IGL02560:Hhip APN 8 79987009 missense probably damaging 0.98
IGL03046:Hhip UTSW 8 79972338 missense probably damaging 0.99
R0068:Hhip UTSW 8 79989256 missense probably damaging 1.00
R0356:Hhip UTSW 8 79997492 missense probably benign 0.20
R0707:Hhip UTSW 8 79998255 missense probably damaging 1.00
R1163:Hhip UTSW 8 79992476 missense probably damaging 1.00
R1583:Hhip UTSW 8 79990276 missense probably damaging 1.00
R1900:Hhip UTSW 8 79975046 missense probably benign 0.15
R2071:Hhip UTSW 8 80057302 missense probably benign 0.00
R2255:Hhip UTSW 8 80045181 missense probably damaging 0.98
R3847:Hhip UTSW 8 79997495 missense probably benign 0.00
R4012:Hhip UTSW 8 79992594 missense probably damaging 1.00
R4448:Hhip UTSW 8 80043945 critical splice donor site probably null
R4607:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4608:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4677:Hhip UTSW 8 80045097 missense probably damaging 0.96
R5040:Hhip UTSW 8 79997606 missense probably benign 0.00
R5371:Hhip UTSW 8 79997591 missense probably damaging 0.98
R5594:Hhip UTSW 8 79996863 missense probably damaging 1.00
R5785:Hhip UTSW 8 79998192 missense possibly damaging 0.84
R6026:Hhip UTSW 8 79972440 missense probably damaging 1.00
R6259:Hhip UTSW 8 79972404 missense probably damaging 1.00
R6782:Hhip UTSW 8 80051604 missense probably damaging 1.00
R7105:Hhip UTSW 8 79975009 missense probably benign 0.04
R7134:Hhip UTSW 8 79992513 missense probably benign
R7238:Hhip UTSW 8 79987012 missense probably benign
R7828:Hhip UTSW 8 79998208 missense probably benign 0.00
R8418:Hhip UTSW 8 80045085 missense probably damaging 0.99
R8814:Hhip UTSW 8 80051472 missense probably damaging 1.00
R8947:Hhip UTSW 8 80045156 missense probably damaging 0.97
X0026:Hhip UTSW 8 79992560 missense possibly damaging 0.93
Z1177:Hhip UTSW 8 80057251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTGCTAGGCCAATGTTTCTATG -3'
(R):5'- CCGAGGTCATTAGCTTCAATAGAG -3'

Sequencing Primer
(F):5'- GCTTTCTCAATGCTCATTATGCAAAC -3'
(R):5'- GTAAACAAACTTGTCAGGATGTTTCC -3'
Posted On2015-11-11