Incidental Mutation 'R4738:Prss38'
ID359448
Institutional Source Beutler Lab
Gene Symbol Prss38
Ensembl Gene ENSMUSG00000049291
Gene Nameprotease, serine 38
SynonymsGm249, LOC216797
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location59372669-59375657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59372945 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 314 (T314A)
Ref Sequence ENSEMBL: ENSMUSP00000052010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061481]
Predicted Effect probably benign
Transcript: ENSMUST00000061481
AA Change: T314A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000052010
Gene: ENSMUSG00000049291
AA Change: T314A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 55 284 7.08e-75 SMART
low complexity region 288 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133698
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Prss38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03075:Prss38 APN 11 59373055 missense probably damaging 1.00
LCD18:Prss38 UTSW 11 59375641 utr 5 prime probably benign
R0001:Prss38 UTSW 11 59373180 splice site probably benign
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0097:Prss38 UTSW 11 59375608 missense possibly damaging 0.86
R0540:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R0607:Prss38 UTSW 11 59375543 missense possibly damaging 0.50
R1966:Prss38 UTSW 11 59373484 missense probably damaging 1.00
R4394:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4397:Prss38 UTSW 11 59373028 missense probably damaging 1.00
R4529:Prss38 UTSW 11 59373499 missense probably damaging 1.00
R5061:Prss38 UTSW 11 59374370 missense probably damaging 0.98
R5219:Prss38 UTSW 11 59375483 splice site probably benign
R5306:Prss38 UTSW 11 59372995 missense probably benign 0.00
R6894:Prss38 UTSW 11 59373024 missense probably benign 0.19
R7286:Prss38 UTSW 11 59375558 missense probably benign 0.00
R7860:Prss38 UTSW 11 59375170 missense probably damaging 1.00
R7943:Prss38 UTSW 11 59375170 missense probably damaging 1.00
T0970:Prss38 UTSW 11 59373148 missense possibly damaging 0.81
Z1176:Prss38 UTSW 11 59374334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTCAGCCTCTTACAGAC -3'
(R):5'- TTTCAGGGTGACTCTGGCAG -3'

Sequencing Primer
(F):5'- ATGCTCAGCCTCTTACAGACTTAGAG -3'
(R):5'- GCAGTCCACTGGTATGTAAGC -3'
Posted On2015-11-11