Incidental Mutation 'R4738:Cyth4'
ID359465
Institutional Source Beutler Lab
Gene Symbol Cyth4
Ensembl Gene ENSMUSG00000018008
Gene Namecytohesin 4
Synonyms5830469K17Rik, 2510004M07Rik, Pscd4
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78597047-78622019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78605874 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 62 (M62I)
Ref Sequence ENSEMBL: ENSMUSP00000155432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043069] [ENSMUST00000229248] [ENSMUST00000229256] [ENSMUST00000229295] [ENSMUST00000229717] [ENSMUST00000229796] [ENSMUST00000231168] [ENSMUST00000231180]
Predicted Effect probably benign
Transcript: ENSMUST00000043069
AA Change: M65I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042698
Gene: ENSMUSG00000018008
AA Change: M65I

DomainStartEndE-ValueType
Sec7 58 243 1.05e-90 SMART
PH 260 377 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229233
Predicted Effect probably benign
Transcript: ENSMUST00000229248
Predicted Effect unknown
Transcript: ENSMUST00000229256
AA Change: C16Y
Predicted Effect probably benign
Transcript: ENSMUST00000229295
AA Change: M62I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect unknown
Transcript: ENSMUST00000229717
AA Change: V44M
Predicted Effect probably benign
Transcript: ENSMUST00000229796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230705
Predicted Effect probably benign
Transcript: ENSMUST00000231168
AA Change: M65I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231176
Predicted Effect probably benign
Transcript: ENSMUST00000231180
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD family of proteins, which have an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family function as GEPs for ADP-ribosylation factors (ARFs), which are guanine nucleotide-binding proteins involved in vesicular trafficking pathways. This protein exhibits GEP activity in vitro with ARF1 and ARF5, but is inactive with ARF6. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Pcdhb9 T C 18: 37,403,415 C821R probably benign Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Cyth4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00936:Cyth4 APN 15 78619913 missense probably benign 0.00
R0522:Cyth4 UTSW 15 78615785 missense possibly damaging 0.67
R0584:Cyth4 UTSW 15 78609878 splice site probably null
R2018:Cyth4 UTSW 15 78608171 missense probably damaging 1.00
R3804:Cyth4 UTSW 15 78609802 missense probably damaging 1.00
R3811:Cyth4 UTSW 15 78604649 missense probably damaging 1.00
R4728:Cyth4 UTSW 15 78602713 missense probably benign 0.01
R5392:Cyth4 UTSW 15 78606985 missense probably damaging 1.00
R5594:Cyth4 UTSW 15 78607075 unclassified probably null
R6414:Cyth4 UTSW 15 78608146 missense probably damaging 0.97
R7241:Cyth4 UTSW 15 78607045 missense probably benign 0.38
R7472:Cyth4 UTSW 15 78605894 missense probably damaging 1.00
R8253:Cyth4 UTSW 15 78602737 missense probably benign 0.09
R8372:Cyth4 UTSW 15 78597135 start gained probably benign
Z1177:Cyth4 UTSW 15 78619919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGCTCAGCTTACAGC -3'
(R):5'- CCAAAGGCTTGTCCCTGTTG -3'

Sequencing Primer
(F):5'- GACACCTCTCAGCCTGTTCTTG -3'
(R):5'- CCTGTTGGGTGGTTTGCAG -3'
Posted On2015-11-11