Incidental Mutation 'R4738:Pcdhb9'
ID359470
Institutional Source Beutler Lab
Gene Symbol Pcdhb9
Ensembl Gene ENSMUSG00000051242
Gene Nameprotocadherin beta 9
SynonymsPcdhbI, Pcdhb4C
MMRRC Submission 041964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4738 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37400855-37403909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37403415 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 821 (C821R)
Ref Sequence ENSEMBL: ENSMUSP00000058801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057228] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000057228
AA Change: C821R

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058801
Gene: ENSMUSG00000051242
AA Change: C821R

DomainStartEndE-ValueType
Pfam:Cadherin_2 65 147 2.3e-33 PFAM
CA 190 275 1.28e-17 SMART
CA 299 380 7.6e-25 SMART
CA 403 484 5.81e-21 SMART
CA 508 594 9.8e-28 SMART
CA 624 705 1.86e-10 SMART
Pfam:Cadherin_C_2 722 805 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,973,983 I176T probably benign Het
Angpt2 C T 8: 18,741,059 D74N probably benign Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Areg T C 5: 91,146,724 I247T possibly damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Atp6v1b2 T A 8: 69,103,410 S246T probably benign Het
Atp8b1 T C 18: 64,545,180 R882G probably benign Het
Atp9a A G 2: 168,668,181 V444A probably benign Het
Babam2 T A 5: 31,901,142 Y211N probably damaging Het
Btbd11 C T 10: 85,627,248 Q626* probably null Het
Ccdc127 T G 13: 74,357,068 probably benign Het
Cep192 A T 18: 67,884,830 K2500* probably null Het
Cnot4 T C 6: 35,051,376 N435S probably benign Het
Col12a1 T C 9: 79,699,282 I620V probably damaging Het
Cyth4 G A 15: 78,605,874 M62I probably benign Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dchs1 C T 7: 105,758,673 R1984Q probably damaging Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Disp2 A G 2: 118,790,326 Y513C probably damaging Het
Dph7 T C 2: 24,963,131 S86P possibly damaging Het
Eif3b T A 5: 140,430,078 M384K probably benign Het
Emc1 G T 4: 139,362,202 G227V possibly damaging Het
Eri2 A G 7: 119,787,732 probably null Het
Frzb A G 2: 80,424,597 probably null Het
Ganc T A 2: 120,452,594 V743D probably damaging Het
Gfpt1 C A 6: 87,054,747 probably benign Het
Gm3086 A T 12: 69,969,381 probably benign Het
Gsdmc2 A T 15: 63,826,801 Y315* probably null Het
Haus6 A G 4: 86,600,749 probably null Het
Hhip C T 8: 79,992,570 D443N probably damaging Het
Isg15 T C 4: 156,199,862 M70V probably benign Het
Kank2 T C 9: 21,774,619 N653S probably damaging Het
Klhdc1 G T 12: 69,283,133 R345S probably benign Het
Larp7 A G 3: 127,546,045 probably null Het
Lgals12 A G 19: 7,604,099 V81A probably benign Het
Lhx9 A G 1: 138,832,748 L288P probably damaging Het
Mcpt9 T A 14: 56,026,999 H213L probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Neb A C 2: 52,187,482 S1846A probably damaging Het
Nr3c2 T C 8: 76,909,307 S346P possibly damaging Het
Olfr1564 A G 17: 33,215,810 F178S probably benign Het
Olfr187 T C 16: 59,036,195 I181V probably benign Het
Olfr376 G T 11: 73,375,350 L200F possibly damaging Het
Olfr487 A T 7: 108,211,994 N178K probably damaging Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Osbpl10 A G 9: 115,216,574 E426G probably damaging Het
Ovgp1 T C 3: 105,979,918 V210A probably damaging Het
Pam A T 1: 97,923,132 V167D probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pbx4 C T 8: 69,864,969 T201M probably damaging Het
Plekhg3 T C 12: 76,576,914 I976T probably damaging Het
Pold1 G A 7: 44,541,329 R304C probably damaging Het
Prss38 T C 11: 59,372,945 T314A probably benign Het
Psph T C 5: 129,769,386 probably null Het
Ptprj G A 2: 90,440,643 P1247L probably damaging Het
Rab3gap1 A G 1: 127,934,436 E648G probably damaging Het
Ralgds A G 2: 28,545,416 E465G probably damaging Het
Rfng T C 11: 120,783,964 T67A probably damaging Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Rps6kl1 G T 12: 85,140,387 F181L probably benign Het
Spata46 G A 1: 170,311,886 M151I possibly damaging Het
Ssbp1 T A 6: 40,477,980 N124K probably damaging Het
Sspo C T 6: 48,478,396 A3064V possibly damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tdpoz4 T C 3: 93,797,089 I231T probably damaging Het
Tff3 G A 17: 31,127,509 P30S probably benign Het
Thg1l C T 11: 45,954,191 R18Q probably damaging Het
Tlk2 T A 11: 105,256,882 H369Q probably benign Het
Tnfaip8 A G 18: 50,090,502 T14A probably damaging Het
Tspan17 T A 13: 54,795,064 C116* probably null Het
Ttn T C 2: 76,880,546 probably benign Het
Tyr T C 7: 87,492,647 Y158C probably null Het
U2af1l4 G T 7: 30,563,348 probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r86 T A 10: 130,447,070 D559V probably damaging Het
Wfikkn2 T A 11: 94,239,076 T80S probably benign Het
Zdhhc2 T A 8: 40,464,142 probably null Het
Zfp521 T C 18: 13,844,054 K1101E possibly damaging Het
Zfp595 A T 13: 67,317,165 F345I probably benign Het
Zswim2 T A 2: 83,915,395 R566S probably benign Het
Other mutations in Pcdhb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pcdhb9 APN 18 37403279 missense possibly damaging 0.59
IGL01557:Pcdhb9 APN 18 37403047 missense probably damaging 1.00
IGL01716:Pcdhb9 APN 18 37403175 missense probably damaging 0.99
IGL01954:Pcdhb9 APN 18 37401741 missense probably damaging 1.00
IGL02063:Pcdhb9 APN 18 37401757 missense probably benign 0.21
IGL03057:Pcdhb9 APN 18 37401277 missense probably benign 0.00
R0140:Pcdhb9 UTSW 18 37402961 missense possibly damaging 0.89
R0180:Pcdhb9 UTSW 18 37402254 missense probably damaging 1.00
R0349:Pcdhb9 UTSW 18 37402579 missense probably damaging 0.99
R0616:Pcdhb9 UTSW 18 37401975 nonsense probably null
R0669:Pcdhb9 UTSW 18 37402255 missense probably damaging 1.00
R1256:Pcdhb9 UTSW 18 37403116 missense possibly damaging 0.94
R1642:Pcdhb9 UTSW 18 37400934 intron probably benign
R1678:Pcdhb9 UTSW 18 37401629 missense probably damaging 1.00
R1711:Pcdhb9 UTSW 18 37403327 nonsense probably null
R1762:Pcdhb9 UTSW 18 37403083 missense probably benign 0.00
R1823:Pcdhb9 UTSW 18 37402818 missense probably benign 0.14
R1868:Pcdhb9 UTSW 18 37402084 missense probably damaging 1.00
R1959:Pcdhb9 UTSW 18 37403316 missense probably damaging 1.00
R2446:Pcdhb9 UTSW 18 37403287 missense probably damaging 0.99
R2889:Pcdhb9 UTSW 18 37403223 missense probably benign 0.06
R2890:Pcdhb9 UTSW 18 37403326 missense probably benign 0.23
R3196:Pcdhb9 UTSW 18 37401610 missense probably benign 0.02
R3725:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R3726:Pcdhb9 UTSW 18 37401601 missense possibly damaging 0.95
R4179:Pcdhb9 UTSW 18 37401115 missense probably benign 0.17
R4326:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4326:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4327:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4327:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4329:Pcdhb9 UTSW 18 37401822 missense probably benign 0.04
R4329:Pcdhb9 UTSW 18 37401823 missense probably benign 0.15
R4626:Pcdhb9 UTSW 18 37402249 missense probably benign 0.01
R4888:Pcdhb9 UTSW 18 37403233 missense probably benign 0.22
R5140:Pcdhb9 UTSW 18 37401133 missense probably benign 0.00
R5186:Pcdhb9 UTSW 18 37401232 missense probably damaging 1.00
R5502:Pcdhb9 UTSW 18 37401603 missense possibly damaging 0.95
R5586:Pcdhb9 UTSW 18 37401114 missense probably benign
R5601:Pcdhb9 UTSW 18 37402206 missense probably damaging 1.00
R5624:Pcdhb9 UTSW 18 37401406 missense probably benign
R5827:Pcdhb9 UTSW 18 37401958 missense possibly damaging 0.72
R5829:Pcdhb9 UTSW 18 37401889 missense probably damaging 0.97
R5837:Pcdhb9 UTSW 18 37402798 missense probably damaging 1.00
R6147:Pcdhb9 UTSW 18 37402441 missense possibly damaging 0.95
R6228:Pcdhb9 UTSW 18 37402062 missense probably benign 0.00
R6245:Pcdhb9 UTSW 18 37403154 missense probably damaging 1.00
R6304:Pcdhb9 UTSW 18 37401367 missense probably damaging 0.99
R6542:Pcdhb9 UTSW 18 37401589 missense probably damaging 0.99
R6904:Pcdhb9 UTSW 18 37401917 missense probably benign 0.01
R7058:Pcdhb9 UTSW 18 37403281 missense probably benign 0.35
R7159:Pcdhb9 UTSW 18 37401492 missense possibly damaging 0.89
R7258:Pcdhb9 UTSW 18 37402114 missense probably damaging 1.00
R7800:Pcdhb9 UTSW 18 37401549 missense probably benign 0.01
R8027:Pcdhb9 UTSW 18 37403016 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGTGAACACTTTCCTGGC -3'
(R):5'- TACTTGAGCTACTTGTAGTCGTGAG -3'

Sequencing Primer
(F):5'- CCACCTGGTCGATGTCAGTG -3'
(R):5'- TTCACCAAAGACACTGAACATGTAG -3'
Posted On2015-11-11