Incidental Mutation 'R4739:Zmynd8'
ID 359491
Institutional Source Beutler Lab
Gene Symbol Zmynd8
Ensembl Gene ENSMUSG00000039671
Gene Name zinc finger, MYND-type containing 8
Synonyms 2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 165784152-165899016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 165805329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 901 (T901M)
Ref Sequence ENSEMBL: ENSMUSP00000104892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000170272] [ENSMUST00000177633]
AlphaFold A2A484
Predicted Effect probably damaging
Transcript: ENSMUST00000018050
AA Change: T845M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: T845M

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 90 131 2.23e-11 SMART
BROMO 147 254 1.77e-17 SMART
Pfam:PWWP 275 349 4e-12 PFAM
Pfam:DUF3544 412 624 9.8e-112 PFAM
internal_repeat_2 640 701 9.06e-5 PROSPERO
low complexity region 770 805 N/A INTRINSIC
low complexity region 853 868 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
coiled coil region 916 978 N/A INTRINSIC
Pfam:zf-MYND 988 1022 2.2e-7 PFAM
low complexity region 1055 1075 N/A INTRINSIC
low complexity region 1142 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088113
AA Change: T840M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: T840M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 271 346 2.7e-11 PFAM
Pfam:DUF3544 408 617 2.1e-102 PFAM
internal_repeat_2 635 696 4.2e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
low complexity region 1050 1070 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099084
AA Change: T872M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: T872M

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 4.1e-12 PFAM
Pfam:DUF3544 387 599 1e-111 PFAM
internal_repeat_2 615 676 4.95e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 819 844 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 943 1005 N/A INTRINSIC
Pfam:zf-MYND 1015 1049 2.3e-7 PFAM
low complexity region 1082 1102 N/A INTRINSIC
low complexity region 1169 1183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109266
AA Change: T865M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: T865M

DomainStartEndE-ValueType
low complexity region 6 11 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 110 151 2.23e-11 SMART
BROMO 167 274 1.77e-17 SMART
Pfam:PWWP 295 369 4.1e-12 PFAM
Pfam:DUF3544 432 644 1e-111 PFAM
internal_repeat_2 660 721 8.36e-5 PROSPERO
low complexity region 790 825 N/A INTRINSIC
low complexity region 873 888 N/A INTRINSIC
low complexity region 895 907 N/A INTRINSIC
coiled coil region 936 998 N/A INTRINSIC
Pfam:zf-MYND 1008 1042 2.3e-7 PFAM
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1162 1176 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109269
AA Change: T901M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: T901M

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
PHD 94 135 2.23e-11 SMART
BROMO 151 258 1.77e-17 SMART
Pfam:PWWP 280 355 6.6e-11 PFAM
Pfam:DUF3544 417 626 2.6e-102 PFAM
internal_repeat_2 644 705 6.15e-5 PROSPERO
low complexity region 774 809 N/A INTRINSIC
low complexity region 848 873 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 931 943 N/A INTRINSIC
coiled coil region 972 1034 N/A INTRINSIC
low complexity region 1111 1131 N/A INTRINSIC
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152682
Predicted Effect probably damaging
Transcript: ENSMUST00000170272
AA Change: T820M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: T820M

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.1e-11 PFAM
Pfam:DUF3544 387 599 1.9e-111 PFAM
internal_repeat_2 615 676 7.92e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
coiled coil region 891 953 N/A INTRINSIC
Pfam:zf-MYND 963 997 1.1e-6 PFAM
low complexity region 1030 1050 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177633
AA Change: T840M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: T840M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 9.6e-12 PFAM
Pfam:DUF3544 407 619 1.8e-111 PFAM
internal_repeat_2 635 696 6.45e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
Pfam:zf-MYND 983 1017 6.7e-7 PFAM
low complexity region 1050 1070 N/A INTRINSIC
low complexity region 1137 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Other mutations in Zmynd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Zmynd8 APN 2 165812814 missense probably damaging 1.00
IGL01311:Zmynd8 APN 2 165805209 missense probably damaging 1.00
IGL02317:Zmynd8 APN 2 165820572 missense possibly damaging 0.92
IGL02548:Zmynd8 APN 2 165833405 missense probably damaging 1.00
IGL02798:Zmynd8 APN 2 165852150 critical splice acceptor site probably null
IGL02933:Zmynd8 APN 2 165828318 missense possibly damaging 0.65
cain UTSW 2 165858053 critical splice donor site probably null
F5770:Zmynd8 UTSW 2 165812394 nonsense probably null
I1329:Zmynd8 UTSW 2 165828225 missense probably damaging 1.00
P0031:Zmynd8 UTSW 2 165820698 splice site probably benign
R0267:Zmynd8 UTSW 2 165828402 missense probably damaging 1.00
R0608:Zmynd8 UTSW 2 165787158 splice site probably null
R1663:Zmynd8 UTSW 2 165807885 missense probably benign 0.11
R2212:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3412:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3413:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3749:Zmynd8 UTSW 2 165805198 missense probably damaging 1.00
R3820:Zmynd8 UTSW 2 165815461 nonsense probably null
R3836:Zmynd8 UTSW 2 165858099 missense probably benign 0.05
R3957:Zmynd8 UTSW 2 165812475 missense probably damaging 0.99
R4379:Zmynd8 UTSW 2 165807938 splice site probably null
R4526:Zmynd8 UTSW 2 165807607 intron probably benign
R4838:Zmynd8 UTSW 2 165840034 nonsense probably null
R4932:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4933:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4997:Zmynd8 UTSW 2 165792816 missense probably benign 0.01
R5652:Zmynd8 UTSW 2 165807698 missense probably damaging 1.00
R5741:Zmynd8 UTSW 2 165840017 missense probably damaging 1.00
R6008:Zmynd8 UTSW 2 165842787 missense possibly damaging 0.77
R6242:Zmynd8 UTSW 2 165898947 missense possibly damaging 0.91
R6332:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R6394:Zmynd8 UTSW 2 165846023 nonsense probably null
R6772:Zmynd8 UTSW 2 165807601 missense probably benign 0.35
R6970:Zmynd8 UTSW 2 165875750 missense probably damaging 1.00
R6986:Zmynd8 UTSW 2 165833415 missense probably damaging 1.00
R7229:Zmynd8 UTSW 2 165858053 critical splice donor site probably null
R7266:Zmynd8 UTSW 2 165807572 missense possibly damaging 0.49
R7296:Zmynd8 UTSW 2 165840009 missense probably damaging 0.98
R7642:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R7818:Zmynd8 UTSW 2 165842831 missense probably damaging 0.97
R7821:Zmynd8 UTSW 2 165881080 intron probably benign
R8135:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R8828:Zmynd8 UTSW 2 165812546 missense probably benign 0.00
R9128:Zmynd8 UTSW 2 165858138 start codon destroyed probably null
R9200:Zmynd8 UTSW 2 165840085 missense probably benign
R9345:Zmynd8 UTSW 2 165812748 missense possibly damaging 0.85
R9478:Zmynd8 UTSW 2 165807649 missense probably damaging 1.00
R9626:Zmynd8 UTSW 2 165812348 critical splice donor site probably null
R9649:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R9759:Zmynd8 UTSW 2 165838826 missense possibly damaging 0.89
V7580:Zmynd8 UTSW 2 165812394 nonsense probably null
V7581:Zmynd8 UTSW 2 165812394 nonsense probably null
V7583:Zmynd8 UTSW 2 165812394 nonsense probably null
Z1088:Zmynd8 UTSW 2 165828171 missense probably benign
Z1176:Zmynd8 UTSW 2 165828188 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGTTAAAGCCTGCAACTTAGCC -3'
(R):5'- TTCGTAGTTCAAACGCTGGC -3'

Sequencing Primer
(F):5'- TTTTTACAAACTACCAAGCCAGGG -3'
(R):5'- TTCAAACGCTGGCTAGGG -3'
Posted On 2015-11-11