Incidental Mutation 'R4739:Npnt'
ID 359497
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Name nephronectin
Synonyms POEM, 1110009H02Rik
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 132587506-132656052 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 132610452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 272 (T272P)
Ref Sequence ENSEMBL: ENSMUSP00000112816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
AlphaFold Q91V88
Predicted Effect possibly damaging
Transcript: ENSMUST00000042729
AA Change: T393P

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: T393P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042744
AA Change: T376P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: T376P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093971
AA Change: T424P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: T424P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117164
AA Change: T407P

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: T407P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117456
AA Change: T272P

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998
AA Change: T272P

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117811
AA Change: T376P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: T376P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132732
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Abraxas1 T A 5: 100,959,886 (GRCm39) K155N probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dnah3 T C 7: 119,677,169 (GRCm39) D444G possibly damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hectd4 A T 5: 121,486,505 (GRCm39) M3167L probably benign Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Mtrf1 G A 14: 79,650,520 (GRCm39) V323M probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132,610,418 (GRCm39) critical splice donor site probably null
IGL01457:Npnt APN 3 132,591,743 (GRCm39) missense probably damaging 1.00
IGL01954:Npnt APN 3 132,615,724 (GRCm39) missense probably damaging 1.00
IGL01999:Npnt APN 3 132,614,160 (GRCm39) missense probably damaging 1.00
IGL02012:Npnt APN 3 132,614,158 (GRCm39) missense probably damaging 1.00
IGL02025:Npnt APN 3 132,596,523 (GRCm39) critical splice donor site probably null
IGL02637:Npnt APN 3 132,590,271 (GRCm39) missense possibly damaging 0.90
R0234:Npnt UTSW 3 132,620,175 (GRCm39) missense possibly damaging 0.82
R0234:Npnt UTSW 3 132,620,175 (GRCm39) missense possibly damaging 0.82
R1680:Npnt UTSW 3 132,612,563 (GRCm39) missense probably benign 0.00
R1729:Npnt UTSW 3 132,620,158 (GRCm39) nonsense probably null
R1773:Npnt UTSW 3 132,610,454 (GRCm39) missense possibly damaging 0.62
R1980:Npnt UTSW 3 132,653,893 (GRCm39) missense probably benign 0.04
R1982:Npnt UTSW 3 132,653,893 (GRCm39) missense probably benign 0.04
R2338:Npnt UTSW 3 132,597,170 (GRCm39) missense probably damaging 1.00
R3800:Npnt UTSW 3 132,612,524 (GRCm39) missense probably damaging 1.00
R4790:Npnt UTSW 3 132,596,523 (GRCm39) critical splice donor site probably benign
R5008:Npnt UTSW 3 132,612,218 (GRCm39) missense probably damaging 1.00
R5446:Npnt UTSW 3 132,614,130 (GRCm39) missense probably damaging 1.00
R5471:Npnt UTSW 3 132,620,148 (GRCm39) missense probably benign 0.05
R5538:Npnt UTSW 3 132,610,724 (GRCm39) missense probably damaging 1.00
R5673:Npnt UTSW 3 132,623,258 (GRCm39) missense probably damaging 0.97
R5683:Npnt UTSW 3 132,612,601 (GRCm39) splice site probably null
R5827:Npnt UTSW 3 132,612,536 (GRCm39) missense possibly damaging 0.89
R5857:Npnt UTSW 3 132,614,110 (GRCm39) missense probably damaging 1.00
R5910:Npnt UTSW 3 132,612,179 (GRCm39) missense probably damaging 1.00
R6208:Npnt UTSW 3 132,655,774 (GRCm39) unclassified probably benign
R6358:Npnt UTSW 3 132,610,479 (GRCm39) missense probably benign 0.18
R6875:Npnt UTSW 3 132,615,671 (GRCm39) missense probably damaging 1.00
R7025:Npnt UTSW 3 132,614,157 (GRCm39) missense probably damaging 1.00
R7145:Npnt UTSW 3 132,615,692 (GRCm39) missense probably benign 0.01
R7166:Npnt UTSW 3 132,653,889 (GRCm39) missense probably damaging 1.00
R7287:Npnt UTSW 3 132,612,563 (GRCm39) missense probably benign 0.00
R7344:Npnt UTSW 3 132,614,100 (GRCm39) splice site probably null
R8344:Npnt UTSW 3 132,614,217 (GRCm39) missense probably damaging 1.00
R8717:Npnt UTSW 3 132,614,136 (GRCm39) missense probably damaging 1.00
R8873:Npnt UTSW 3 132,655,816 (GRCm39) start gained probably benign
R8903:Npnt UTSW 3 132,591,764 (GRCm39) missense probably damaging 1.00
R9414:Npnt UTSW 3 132,612,116 (GRCm39) missense probably benign 0.00
R9420:Npnt UTSW 3 132,653,866 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTAGAGTTGAACGCCATC -3'
(R):5'- TGTCATTACCAACAGGCCTAC -3'

Sequencing Primer
(F):5'- GCAGTCATAGTTCTTGCAACG -3'
(R):5'- TTACCAACAGGCCTACTTCCAAG -3'
Posted On 2015-11-11