Incidental Mutation 'R4739:Eya3'
ID 359501
Institutional Source Beutler Lab
Gene Symbol Eya3
Ensembl Gene ENSMUSG00000028886
Gene Name EYA transcriptional coactivator and phosphatase 3
Synonyms
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 132638987-132724765 bp(+) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to A at 132721387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020197] [ENSMUST00000045550] [ENSMUST00000079157] [ENSMUST00000081726] [ENSMUST00000180250]
AlphaFold P97480
Predicted Effect probably benign
Transcript: ENSMUST00000020197
SMART Domains Protein: ENSMUSP00000020197
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000045550
SMART Domains Protein: ENSMUSP00000041205
Gene: ENSMUSG00000037752

DomainStartEndE-ValueType
Pfam:XK-related 14 345 2.3e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079157
SMART Domains Protein: ENSMUSP00000078157
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 72 89 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
PDB:4EGC|B 226 510 1e-135 PDB
SCOP:d1lvha_ 345 507 8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081726
SMART Domains Protein: ENSMUSP00000080425
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
Pfam:Hydrolase 256 502 5.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157029
Predicted Effect probably benign
Transcript: ENSMUST00000180250
SMART Domains Protein: ENSMUSP00000136812
Gene: ENSMUSG00000028886

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
PDB:4EGC|B 132 416 1e-136 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal heart function, decreased grip strength and increased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Eya3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Eya3 APN 4 132704398 missense probably damaging 1.00
IGL01104:Eya3 APN 4 132711929 missense probably damaging 1.00
IGL01109:Eya3 APN 4 132693000 nonsense probably null
IGL01145:Eya3 APN 4 132709995 missense probably damaging 1.00
IGL02364:Eya3 APN 4 132710055 missense probably damaging 1.00
IGL03008:Eya3 APN 4 132706983 missense probably damaging 1.00
IGL03144:Eya3 APN 4 132693142 missense probably benign 0.07
IGL03176:Eya3 APN 4 132711922 missense possibly damaging 0.90
R0279:Eya3 UTSW 4 132719247 missense probably damaging 1.00
R0621:Eya3 UTSW 4 132694802 missense probably benign 0.00
R0893:Eya3 UTSW 4 132689786 missense probably benign 0.01
R1416:Eya3 UTSW 4 132707129 splice site probably benign
R1834:Eya3 UTSW 4 132707118 missense probably damaging 0.99
R1903:Eya3 UTSW 4 132721352 splice site probably null
R4696:Eya3 UTSW 4 132670232 nonsense probably null
R4758:Eya3 UTSW 4 132694885 critical splice donor site probably null
R5061:Eya3 UTSW 4 132704378 missense probably damaging 1.00
R5411:Eya3 UTSW 4 132689779 missense probably damaging 0.99
R5479:Eya3 UTSW 4 132672933 missense possibly damaging 0.91
R6117:Eya3 UTSW 4 132711862 missense probably damaging 1.00
R6343:Eya3 UTSW 4 132672910 missense probably damaging 0.96
R6443:Eya3 UTSW 4 132711927 missense probably damaging 1.00
R6460:Eya3 UTSW 4 132680863 missense probably damaging 0.97
R7116:Eya3 UTSW 4 132694799 missense probably benign 0.00
R7418:Eya3 UTSW 4 132680848 missense possibly damaging 0.92
R7594:Eya3 UTSW 4 132694825 missense probably benign
R7624:Eya3 UTSW 4 132672951 missense probably benign 0.41
R7811:Eya3 UTSW 4 132711961 missense possibly damaging 0.64
R9140:Eya3 UTSW 4 132701100 missense possibly damaging 0.55
R9642:Eya3 UTSW 4 132699063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCAAGCATAGACGGTTAC -3'
(R):5'- CTTGCTGTACAGGGGACATG -3'

Sequencing Primer
(F):5'- TTACCAAGAGCCTCAAGGTGTCTG -3'
(R):5'- GCTGCAGCTCACTCAGAATAACTG -3'
Posted On 2015-11-11