Mutagenetix > Incidental Mutation

Incidental Mutation 'R4739:Eif4g3'

359504

Institutional Source

Beutler Lab

Gene Symbol

Eif4g3

Ensembl Gene

ENSMUSG00000028760

Gene Name

eukaryotic translation initiation factor 4 gamma, 3

Synonyms

1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII

MMRRC Submission

042025-MU

Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R4739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137993022-138208508 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 138183199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1330 (L1330P)

Ref Sequence

ENSEMBL: ENSMUSP00000145147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084214
AA Change: L1146P

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: L1146P

Domain	Start	End	E-Value	Type
low complexity region	24	43	N/A	INTRINSIC
low complexity region	93	120	N/A	INTRINSIC
low complexity region	147	152	N/A	INTRINSIC
PDB:1LJ2\|D	154	179	8e-9	PDB
low complexity region	192	207	N/A	INTRINSIC
low complexity region	269	310	N/A	INTRINSIC
low complexity region	427	444	N/A	INTRINSIC
low complexity region	534	550	N/A	INTRINSIC
low complexity region	579	588	N/A	INTRINSIC
low complexity region	592	616	N/A	INTRINSIC
Blast:MIF4G	617	708	5e-49	BLAST
Blast:MIF4G	722	765	5e-16	BLAST
MIF4G	768	996	1.42e-65	SMART
low complexity region	1086	1109	N/A	INTRINSIC
MA3	1215	1327	9.29e-38	SMART
eIF5C	1487	1574	7.92e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084215
AA Change: L1147P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: L1147P

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
low complexity region	75	102	N/A	INTRINSIC
low complexity region	129	134	N/A	INTRINSIC
PDB:1LJ2\|D	136	161	8e-9	PDB
low complexity region	174	189	N/A	INTRINSIC
low complexity region	251	292	N/A	INTRINSIC
low complexity region	409	426	N/A	INTRINSIC
low complexity region	516	532	N/A	INTRINSIC
low complexity region	561	570	N/A	INTRINSIC
low complexity region	574	598	N/A	INTRINSIC
Blast:MIF4G	599	690	4e-49	BLAST
Blast:MIF4G	704	747	5e-16	BLAST
MIF4G	750	978	1.42e-65	SMART
low complexity region	1068	1113	N/A	INTRINSIC
MA3	1216	1328	9.29e-38	SMART
eIF5C	1488	1575	7.92e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105831
AA Change: L1135P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: L1135P

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
low complexity region	82	109	N/A	INTRINSIC
low complexity region	136	141	N/A	INTRINSIC
PDB:1LJ2\|D	143	168	8e-9	PDB
low complexity region	181	196	N/A	INTRINSIC
low complexity region	258	299	N/A	INTRINSIC
low complexity region	416	433	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC
low complexity region	568	577	N/A	INTRINSIC
low complexity region	581	605	N/A	INTRINSIC
Blast:MIF4G	606	697	4e-49	BLAST
Blast:MIF4G	711	754	5e-16	BLAST
MIF4G	757	985	1.42e-65	SMART
low complexity region	1075	1098	N/A	INTRINSIC
MA3	1204	1316	9.29e-38	SMART
eIF5C	1476	1563	7.92e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133902

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140317

Predicted Effect

probably benign
Transcript: ENSMUST00000140796
AA Change: L570P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: L570P

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
low complexity region	16	40	N/A	INTRINSIC
Blast:MIF4G	41	132	2e-49	BLAST
Blast:MIF4G	146	189	3e-16	BLAST
MIF4G	192	420	1.42e-65	SMART
low complexity region	510	533	N/A	INTRINSIC
MA3	639	751	9.29e-38	SMART
eIF5C	911	998	7.92e-36	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203828
AA Change: L1330P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: L1330P

Domain	Start	End	E-Value	Type
low complexity region	41	81	N/A	INTRINSIC
low complexity region	193	208	N/A	INTRINSIC
low complexity region	258	285	N/A	INTRINSIC
low complexity region	312	317	N/A	INTRINSIC
PDB:1LJ2\|D	319	344	9e-9	PDB
low complexity region	357	372	N/A	INTRINSIC
low complexity region	434	475	N/A	INTRINSIC
low complexity region	592	609	N/A	INTRINSIC
low complexity region	699	715	N/A	INTRINSIC
low complexity region	744	753	N/A	INTRINSIC
low complexity region	757	781	N/A	INTRINSIC
Blast:MIF4G	782	873	9e-49	BLAST
Blast:MIF4G	887	930	5e-16	BLAST
MIF4G	933	1161	6e-68	SMART
coiled coil region	1174	1201	N/A	INTRINSIC
low complexity region	1251	1296	N/A	INTRINSIC
MA3	1399	1511	3.9e-40	SMART
eIF5C	1671	1758	3.9e-38	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

96% (102/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]

Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	T	1: 158,969,334		noncoding transcript	Het
2300002M23Rik	A	G	17: 35,567,506		probably benign	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abcc5	T	A	16: 20,399,626	D283V	probably damaging	Het
Abraxas1	T	A	5: 100,812,020	K155N	probably damaging	Het
Acot3	T	C	12: 84,058,590	I277T	probably benign	Het
Ankrd45	G	A	1: 161,155,390	C157Y	probably damaging	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgef11	G	A	3: 87,697,999	V214M	possibly damaging	Het
Ash1l	A	C	3: 88,982,845	N677T	probably benign	Het
Atg13	A	G	2: 91,684,695	S254P	probably damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Avl9	T	A	6: 56,726,309	V120D	probably damaging	Het
Cc2d1b	T	C	4: 108,628,042	V527A	probably benign	Het
Ccnl1	A	G	3: 65,946,671		probably benign	Het
Cenpl	T	A	1: 161,083,267	D261E	probably damaging	Het
Cep192	T	G	18: 67,851,732	I1604M	probably benign	Het
Cep95	A	G	11: 106,815,734	I573V	probably benign	Het
Cfap100	A	G	6: 90,412,843		probably null	Het
Cmc1	T	A	9: 118,075,177	M49L	probably benign	Het
Cyfip2	G	T	11: 46,279,993	N176K	probably damaging	Het
Cyp2w1	T	C	5: 139,356,675	F408L	probably damaging	Het
D630045J12Rik	G	A	6: 38,196,036	S399F	possibly damaging	Het
Dcbld2	T	A	16: 58,460,976	L528Q	probably damaging	Het
Dip2b	T	C	15: 100,207,777	V1138A	probably damaging	Het
Dip2c	T	A	13: 9,533,339	L119Q	probably damaging	Het
Dnah3	T	C	7: 120,077,946	D444G	possibly damaging	Het
Dsg1c	A	T	18: 20,275,189	N432Y	possibly damaging	Het
Dst	T	A	1: 34,191,147	I2785N	probably benign	Het
Dynap	A	T	18: 70,241,225	Y77N	possibly damaging	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Enpp5	C	T	17: 44,081,136	T152I	probably damaging	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Erc2	T	G	14: 27,776,881	L238R	probably damaging	Het
Eya3	T	A	4: 132,721,387		probably benign	Het
Farp1	T	C	14: 121,238,787	F339L	probably damaging	Het
Fsip2	A	C	2: 82,975,353	D672A	possibly damaging	Het
Gap43	G	T	16: 42,292,218	P60Q	probably benign	Het
Gatsl3	A	G	11: 4,219,004	E57G	possibly damaging	Het
Gpr37l1	T	A	1: 135,167,045	I154F	probably damaging	Het
Greb1	A	G	12: 16,696,328	S1314P	probably damaging	Het
Hectd4	A	T	5: 121,348,442	M3167L	probably benign	Het
Hps3	C	T	3: 20,030,410		probably null	Het
Hps5	A	G	7: 46,786,589	C178R	probably benign	Het
Hspg2	T	A	4: 137,570,073		probably benign	Het
Impdh2-ps	A	G	8: 100,031,207		noncoding transcript	Het
Josd2	T	A	7: 44,471,254	N138K	probably damaging	Het
Mtmr6	T	G	14: 60,292,097	M315R	probably damaging	Het
Mtrf1	G	A	14: 79,413,080	V323M	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo18a	T	C	11: 77,823,323	Y748H	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nek1	A	T	8: 61,098,511	N853I	probably benign	Het
Npnt	T	G	3: 132,904,691	T272P	possibly damaging	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr1390	G	A	11: 49,341,321	G263D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr668	G	A	7: 104,924,810	T318I	possibly damaging	Het
Olfr694	C	A	7: 106,689,144	E196*	probably null	Het
Olfr76	A	G	19: 12,119,870	Y269H	possibly damaging	Het
Pappa2	T	G	1: 158,957,002	D146A	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pcsk9	C	T	4: 106,447,156	G496R	probably damaging	Het
Pes1	A	G	11: 3,964,058	K8E	probably damaging	Het
Phlpp2	G	A	8: 109,940,420	G1194S	probably damaging	Het
Pkn1	A	C	8: 83,671,749	V763G	probably damaging	Het
Pkp2	C	A	16: 16,230,724	A331E	probably damaging	Het
Plb1	T	A	5: 32,349,679		probably null	Het
Plxna1	A	T	6: 89,332,675		probably null	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Prkag3	T	C	1: 74,740,705	*490W	probably null	Het
Prl2c1	T	C	13: 27,857,678	C228R	probably damaging	Het
Pus7l	T	C	15: 94,540,710	S85G	probably benign	Het
Rfc3	A	C	5: 151,644,776		probably benign	Het
Riox2	A	G	16: 59,489,369	N362S	probably benign	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Scaper	A	T	9: 55,743,648	D904E	probably damaging	Het
Scn11a	T	C	9: 119,754,561	M1663V	probably benign	Het
Slc13a3	A	T	2: 165,430,289	I278N	possibly damaging	Het
Slc22a7	T	C	17: 46,434,997	E278G	probably damaging	Het
Snrnp48	T	A	13: 38,209,917	M66K	probably damaging	Het
Styk1	T	G	6: 131,300,466	E404A	probably damaging	Het
Synj1	T	A	16: 90,955,419	H1016L	probably benign	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tjp2	T	C	19: 24,120,111		probably null	Het
Tmem87a	A	G	2: 120,360,037		probably null	Het
Trappc9	T	G	15: 72,937,060	Y718S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ugt2a3	C	T	5: 87,327,195	G397R	probably damaging	Het
Wdr33	T	A	18: 31,886,086	M454K	probably benign	Het
Wdtc1	G	T	4: 133,301,799	N325K	possibly damaging	Het
Whrn	T	C	4: 63,418,165	H720R	probably damaging	Het
Xirp2	A	T	2: 67,519,265	D3268V	probably damaging	Het
Zc3h7a	A	T	16: 11,141,709	H793Q	probably damaging	Het
Zfp518b	C	T	5: 38,674,498	A55T	possibly damaging	Het
Zmynd8	G	A	2: 165,805,329	T901M	probably damaging	Het

Other mutations in Eif4g3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01817:Eif4g3	APN	4	138120362	missense	probably benign	0.01
IGL02171:Eif4g3	APN	4	138126589	missense	probably benign	0.03
IGL02487:Eif4g3	APN	4	138203378	missense	possibly damaging	0.92
IGL02514:Eif4g3	APN	4	138126194	missense	possibly damaging	0.87
IGL02622:Eif4g3	APN	4	138097366	splice site	probably benign
IGL02725:Eif4g3	APN	4	138170471	splice site	probably benign
IGL02735:Eif4g3	APN	4	138126211	missense	probably benign	0.40
IGL03008:Eif4g3	APN	4	138120388	missense	probably damaging	1.00
IGL03077:Eif4g3	APN	4	138125855	missense	probably damaging	1.00
N/A - 535:Eif4g3	UTSW	4	138120428	missense	probably damaging	0.98
R0013:Eif4g3	UTSW	4	138175848	missense	possibly damaging	0.88
R0193:Eif4g3	UTSW	4	138146376	splice site	probably benign
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0240:Eif4g3	UTSW	4	138170562	missense	probably damaging	0.98
R0563:Eif4g3	UTSW	4	138175840	splice site	probably benign
R0841:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R0884:Eif4g3	UTSW	4	138151776	missense	possibly damaging	0.76
R1116:Eif4g3	UTSW	4	138091775	critical splice donor site	probably null
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1145:Eif4g3	UTSW	4	138165818	missense	probably damaging	1.00
R1192:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R1401:Eif4g3	UTSW	4	138206084	missense	probably damaging	0.99
R1535:Eif4g3	UTSW	4	138097302	missense	probably damaging	1.00
R1571:Eif4g3	UTSW	4	138120408	missense	probably damaging	1.00
R1576:Eif4g3	UTSW	4	138096870	missense	probably damaging	0.99
R1607:Eif4g3	UTSW	4	138126563	missense	probably benign	0.00
R1618:Eif4g3	UTSW	4	138206058	missense	probably damaging	1.00
R1793:Eif4g3	UTSW	4	138171131	missense	probably damaging	1.00
R1823:Eif4g3	UTSW	4	138180491	missense	probably benign	0.37
R1857:Eif4g3	UTSW	4	138175876	missense	possibly damaging	0.67
R1907:Eif4g3	UTSW	4	138158415	missense	probably damaging	1.00
R2041:Eif4g3	UTSW	4	138105306	splice site	probably benign
R2106:Eif4g3	UTSW	4	138082919	start gained	probably benign
R2124:Eif4g3	UTSW	4	138184742	missense	probably damaging	1.00
R2301:Eif4g3	UTSW	4	138172659	missense	probably damaging	1.00
R2519:Eif4g3	UTSW	4	138097318	missense	probably benign	0.37
R3033:Eif4g3	UTSW	4	138103410	missense	probably damaging	1.00
R3870:Eif4g3	UTSW	4	138096900	missense	probably damaging	0.98
R4542:Eif4g3	UTSW	4	138203417	missense	probably damaging	0.99
R4582:Eif4g3	UTSW	4	138171245	missense	probably damaging	1.00
R4607:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4608:Eif4g3	UTSW	4	138126458	missense	probably benign	0.03
R4658:Eif4g3	UTSW	4	138206132	missense	probably damaging	1.00
R4736:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4739:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4740:Eif4g3	UTSW	4	138198097	missense	probably benign	0.01
R4760:Eif4g3	UTSW	4	138084318	missense	possibly damaging	0.46
R4825:Eif4g3	UTSW	4	138194081	missense	probably benign
R4826:Eif4g3	UTSW	4	138177945	missense	possibly damaging	0.95
R4941:Eif4g3	UTSW	4	138170565	missense	probably damaging	1.00
R5040:Eif4g3	UTSW	4	138096889	missense	probably damaging	0.99
R5070:Eif4g3	UTSW	4	138146299	missense	probably benign	0.00
R5155:Eif4g3	UTSW	4	138126743	missense	probably benign	0.36
R5226:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5229:Eif4g3	UTSW	4	138096794	missense	possibly damaging	0.93
R5303:Eif4g3	UTSW	4	138126562	missense	probably benign	0.04
R5369:Eif4g3	UTSW	4	138183334	missense	possibly damaging	0.87
R5394:Eif4g3	UTSW	4	138103398	splice site	probably null
R5665:Eif4g3	UTSW	4	138126589	missense	probably benign	0.03
R5678:Eif4g3	UTSW	4	138151742	missense	probably damaging	0.99
R5695:Eif4g3	UTSW	4	138163433	splice site	probably null
R5704:Eif4g3	UTSW	4	138190692	missense	probably damaging	1.00
R5924:Eif4g3	UTSW	4	138201926	missense	probably damaging	1.00
R6214:Eif4g3	UTSW	4	138058003	missense	probably damaging	0.99
R6278:Eif4g3	UTSW	4	138188083	missense	possibly damaging	0.82
R6519:Eif4g3	UTSW	4	137994008	missense	probably benign
R6659:Eif4g3	UTSW	4	138177932	missense	probably damaging	1.00
R6720:Eif4g3	UTSW	4	138175832	splice site	probably null
R6812:Eif4g3	UTSW	4	138103376	missense	probably damaging	1.00
R6922:Eif4g3	UTSW	4	138097335	missense	probably damaging	1.00
R7175:Eif4g3	UTSW	4	138126215	missense	probably damaging	1.00
R7176:Eif4g3	UTSW	4	138171186	missense	probably damaging	1.00
R7598:Eif4g3	UTSW	4	138194124	missense	probably benign	0.02
R7618:Eif4g3	UTSW	4	138171118	missense	probably damaging	1.00
R7805:Eif4g3	UTSW	4	138146354	missense	probably benign	0.00
R7935:Eif4g3	UTSW	4	138096771	missense	probably damaging	1.00
R7983:Eif4g3	UTSW	4	138151593	missense	probably benign	0.00
R8261:Eif4g3	UTSW	4	138171118	missense	possibly damaging	0.46
R8371:Eif4g3	UTSW	4	138096845	missense	probably damaging	1.00
R8499:Eif4g3	UTSW	4	138165928	missense	probably damaging	1.00
R8670:Eif4g3	UTSW	4	138158512	critical splice donor site	probably null
R8672:Eif4g3	UTSW	4	138126512	missense	possibly damaging	0.75
R8744:Eif4g3	UTSW	4	137994061	small deletion	probably benign
R8767:Eif4g3	UTSW	4	138203468	missense	probably damaging	0.99
R8771:Eif4g3	UTSW	4	138180537	nonsense	probably null
R8989:Eif4g3	UTSW	4	138184748	missense	probably damaging	1.00
R9292:Eif4g3	UTSW	4	138194071	missense	possibly damaging	0.82
R9294:Eif4g3	UTSW	4	138190657	missense	probably damaging	0.98
R9607:Eif4g3	UTSW	4	138165734	missense	probably benign	0.28
R9617:Eif4g3	UTSW	4	138096879	missense	probably damaging	0.99
RF008:Eif4g3	UTSW	4	138175924	missense	probably damaging	0.98
X0067:Eif4g3	UTSW	4	138163619	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACTAGTCTGGTGCTTTCCAATC -3'
(R):5'- AGCCAATAGGAGGTCTGTCTTG -3'

Sequencing Primer
(F):5'- CTGGTGCTTTCCAATCACGGG -3'
(R):5'- CAATAGGAGGTCTGTCTTGCATCC -3'

Posted On

2015-11-11