Mutagenetix > Incidental Mutation

Incidental Mutation 'R4739:Plb1'

359506

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

042025-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R4739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to A at 32349679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

AlphaFold

Q3TTY0

Predicted Effect

probably null
Transcript: ENSMUST00000101376

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202220

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202453

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202688

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

96% (102/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012P17Rik	C	T	1: 158,969,334		noncoding transcript	Het
2300002M23Rik	A	G	17: 35,567,506		probably benign	Het
Aadat	T	C	8: 60,540,106	V360A	probably benign	Het
Abcc5	T	A	16: 20,399,626	D283V	probably damaging	Het
Abraxas1	T	A	5: 100,812,020	K155N	probably damaging	Het
Acot3	T	C	12: 84,058,590	I277T	probably benign	Het
Ankrd45	G	A	1: 161,155,390	C157Y	probably damaging	Het
Apol10a	C	T	15: 77,488,641	T159I	possibly damaging	Het
Arhgef11	G	A	3: 87,697,999	V214M	possibly damaging	Het
Ash1l	A	C	3: 88,982,845	N677T	probably benign	Het
Atg13	A	G	2: 91,684,695	S254P	probably damaging	Het
Atg16l2	A	G	7: 101,297,178	L129P	probably damaging	Het
Avl9	T	A	6: 56,726,309	V120D	probably damaging	Het
Cc2d1b	T	C	4: 108,628,042	V527A	probably benign	Het
Ccnl1	A	G	3: 65,946,671		probably benign	Het
Cenpl	T	A	1: 161,083,267	D261E	probably damaging	Het
Cep192	T	G	18: 67,851,732	I1604M	probably benign	Het
Cep95	A	G	11: 106,815,734	I573V	probably benign	Het
Cfap100	A	G	6: 90,412,843		probably null	Het
Cmc1	T	A	9: 118,075,177	M49L	probably benign	Het
Cyfip2	G	T	11: 46,279,993	N176K	probably damaging	Het
Cyp2w1	T	C	5: 139,356,675	F408L	probably damaging	Het
D630045J12Rik	G	A	6: 38,196,036	S399F	possibly damaging	Het
Dcbld2	T	A	16: 58,460,976	L528Q	probably damaging	Het
Dip2b	T	C	15: 100,207,777	V1138A	probably damaging	Het
Dip2c	T	A	13: 9,533,339	L119Q	probably damaging	Het
Dnah3	T	C	7: 120,077,946	D444G	possibly damaging	Het
Dsg1c	A	T	18: 20,275,189	N432Y	possibly damaging	Het
Dst	T	A	1: 34,191,147	I2785N	probably benign	Het
Dynap	A	T	18: 70,241,225	Y77N	possibly damaging	Het
Eif4g3	T	C	4: 138,183,199	L1330P	possibly damaging	Het
Eif4g3	T	A	4: 138,198,097	S1584T	probably benign	Het
Enpp1	A	T	10: 24,679,248	C67S	probably null	Het
Enpp5	C	T	17: 44,081,136	T152I	probably damaging	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Erc2	T	G	14: 27,776,881	L238R	probably damaging	Het
Eya3	T	A	4: 132,721,387		probably benign	Het
Farp1	T	C	14: 121,238,787	F339L	probably damaging	Het
Fsip2	A	C	2: 82,975,353	D672A	possibly damaging	Het
Gap43	G	T	16: 42,292,218	P60Q	probably benign	Het
Gatsl3	A	G	11: 4,219,004	E57G	possibly damaging	Het
Gpr37l1	T	A	1: 135,167,045	I154F	probably damaging	Het
Greb1	A	G	12: 16,696,328	S1314P	probably damaging	Het
Hectd4	A	T	5: 121,348,442	M3167L	probably benign	Het
Hps3	C	T	3: 20,030,410		probably null	Het
Hps5	A	G	7: 46,786,589	C178R	probably benign	Het
Hspg2	T	A	4: 137,570,073		probably benign	Het
Impdh2-ps	A	G	8: 100,031,207		noncoding transcript	Het
Josd2	T	A	7: 44,471,254	N138K	probably damaging	Het
Mtmr6	T	G	14: 60,292,097	M315R	probably damaging	Het
Mtrf1	G	A	14: 79,413,080	V323M	probably damaging	Het
Myo16	G	T	8: 10,373,527	G288W	probably damaging	Het
Myo18a	T	C	11: 77,823,323	Y748H	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nek1	A	T	8: 61,098,511	N853I	probably benign	Het
Npnt	T	G	3: 132,904,691	T272P	possibly damaging	Het
Olfr11	T	A	13: 21,639,170	M118L	possibly damaging	Het
Olfr1390	G	A	11: 49,341,321	G263D	probably benign	Het
Olfr558	T	A	7: 102,710,171	I304N	probably damaging	Het
Olfr668	G	A	7: 104,924,810	T318I	possibly damaging	Het
Olfr694	C	A	7: 106,689,144	E196*	probably null	Het
Olfr76	A	G	19: 12,119,870	Y269H	possibly damaging	Het
Pappa2	T	G	1: 158,957,002	D146A	probably damaging	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Pcsk9	C	T	4: 106,447,156	G496R	probably damaging	Het
Pes1	A	G	11: 3,964,058	K8E	probably damaging	Het
Phlpp2	G	A	8: 109,940,420	G1194S	probably damaging	Het
Pkn1	A	C	8: 83,671,749	V763G	probably damaging	Het
Pkp2	C	A	16: 16,230,724	A331E	probably damaging	Het
Plxna1	A	T	6: 89,332,675		probably null	Het
Polq	C	T	16: 37,041,747	T264M	probably damaging	Het
Prkag3	T	C	1: 74,740,705	*490W	probably null	Het
Prl2c1	T	C	13: 27,857,678	C228R	probably damaging	Het
Pus7l	T	C	15: 94,540,710	S85G	probably benign	Het
Rfc3	A	C	5: 151,644,776		probably benign	Het
Riox2	A	G	16: 59,489,369	N362S	probably benign	Het
Rnf219	C	T	14: 104,510,383	D43N	probably damaging	Het
Scaper	A	T	9: 55,743,648	D904E	probably damaging	Het
Scn11a	T	C	9: 119,754,561	M1663V	probably benign	Het
Slc13a3	A	T	2: 165,430,289	I278N	possibly damaging	Het
Slc22a7	T	C	17: 46,434,997	E278G	probably damaging	Het
Snrnp48	T	A	13: 38,209,917	M66K	probably damaging	Het
Styk1	T	G	6: 131,300,466	E404A	probably damaging	Het
Synj1	T	A	16: 90,955,419	H1016L	probably benign	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tjp2	T	C	19: 24,120,111		probably null	Het
Tmem87a	A	G	2: 120,360,037		probably null	Het
Trappc9	T	G	15: 72,937,060	Y718S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ugt2a3	C	T	5: 87,327,195	G397R	probably damaging	Het
Wdr33	T	A	18: 31,886,086	M454K	probably benign	Het
Wdtc1	G	T	4: 133,301,799	N325K	possibly damaging	Het
Whrn	T	C	4: 63,418,165	H720R	probably damaging	Het
Xirp2	A	T	2: 67,519,265	D3268V	probably damaging	Het
Zc3h7a	A	T	16: 11,141,709	H793Q	probably damaging	Het
Zfp518b	C	T	5: 38,674,498	A55T	possibly damaging	Het
Zmynd8	G	A	2: 165,805,329	T901M	probably damaging	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
R8560:Plb1	UTSW	5	32302679	missense	possibly damaging	0.95
R8770:Plb1	UTSW	5	32247509	missense	unknown
R8857:Plb1	UTSW	5	32364212	missense	unknown
R9029:Plb1	UTSW	5	32281735	missense	probably damaging	0.99
R9110:Plb1	UTSW	5	32364058	missense	probably benign	0.00
R9765:Plb1	UTSW	5	32355387	missense	probably damaging	1.00
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTAAGACTCAGATCCTGCCC -3'
(R):5'- GTGATCTTGGCCAACTCCTC -3'

Sequencing Primer
(F):5'- GCTCCCTGGTGAGAAAAAGCC -3'
(R):5'- GGCCAACTCCTCATTCCAC -3'

Posted On

2015-11-11