Incidental Mutation 'R4739:Abraxas1'
ID 359509
Institutional Source Beutler Lab
Gene Symbol Abraxas1
Ensembl Gene ENSMUSG00000035234
Gene Name BRCA1 A complex subunit
Synonyms 3830405G04Rik, Ccdc98, Fam175a, 5630400M01Rik
MMRRC Submission 042025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R4739 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 100953058-100968831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100959886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 155 (K155N)
Ref Sequence ENSEMBL: ENSMUSP00000143465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044535] [ENSMUST00000055245] [ENSMUST00000117364] [ENSMUST00000129358] [ENSMUST00000153302] [ENSMUST00000200657]
AlphaFold Q8BPZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000044535
AA Change: K155N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000055245
AA Change: K155N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055895
Gene: ENSMUSG00000035234
AA Change: K155N

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117364
AA Change: K155N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114050
Gene: ENSMUSG00000035234
AA Change: K155N

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145429
Predicted Effect probably benign
Transcript: ENSMUST00000153302
Predicted Effect probably damaging
Transcript: ENSMUST00000200657
AA Change: K155N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143465
Gene: ENSMUSG00000035234
AA Change: K155N

DomainStartEndE-ValueType
coiled coil region 210 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199779
Meta Mutation Damage Score 0.1260 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the C-terminal repeats of breast cancer 1 (BRCA1) through a phospho-SXXF motif. The encoded protein recruits ubiquitin interaction motif containing 1 protein to BRCA1 protein and is required for DNA damage resistance, DNA repair, and cell cycle checkpoint control. Pseudogenes of this gene are found on chromosomes 3 and 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,796,904 (GRCm39) noncoding transcript Het
2300002M23Rik A G 17: 35,878,403 (GRCm39) probably benign Het
Aadat T C 8: 60,993,140 (GRCm39) V360A probably benign Het
Abcc5 T A 16: 20,218,376 (GRCm39) D283V probably damaging Het
Acot3 T C 12: 84,105,364 (GRCm39) I277T probably benign Het
Ankrd45 G A 1: 160,982,960 (GRCm39) C157Y probably damaging Het
Apol10a C T 15: 77,372,841 (GRCm39) T159I possibly damaging Het
Arhgef11 G A 3: 87,605,306 (GRCm39) V214M possibly damaging Het
Ash1l A C 3: 88,890,152 (GRCm39) N677T probably benign Het
Atg13 A G 2: 91,515,040 (GRCm39) S254P probably damaging Het
Atg16l2 A G 7: 100,946,385 (GRCm39) L129P probably damaging Het
Avl9 T A 6: 56,703,294 (GRCm39) V120D probably damaging Het
Castor1 A G 11: 4,169,004 (GRCm39) E57G possibly damaging Het
Cc2d1b T C 4: 108,485,239 (GRCm39) V527A probably benign Het
Ccnl1 A G 3: 65,854,092 (GRCm39) probably benign Het
Cenpl T A 1: 160,910,837 (GRCm39) D261E probably damaging Het
Cep192 T G 18: 67,984,803 (GRCm39) I1604M probably benign Het
Cep95 A G 11: 106,706,560 (GRCm39) I573V probably benign Het
Cfap100 A G 6: 90,389,825 (GRCm39) probably null Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cmc1 T A 9: 117,904,245 (GRCm39) M49L probably benign Het
Cyfip2 G T 11: 46,170,820 (GRCm39) N176K probably damaging Het
Cyp2w1 T C 5: 139,342,430 (GRCm39) F408L probably damaging Het
D630045J12Rik G A 6: 38,172,971 (GRCm39) S399F possibly damaging Het
Dcbld2 T A 16: 58,281,339 (GRCm39) L528Q probably damaging Het
Dip2b T C 15: 100,105,658 (GRCm39) V1138A probably damaging Het
Dip2c T A 13: 9,583,375 (GRCm39) L119Q probably damaging Het
Dnah3 T C 7: 119,677,169 (GRCm39) D444G possibly damaging Het
Dsg1c A T 18: 20,408,246 (GRCm39) N432Y possibly damaging Het
Dst T A 1: 34,230,228 (GRCm39) I2785N probably benign Het
Dynap A T 18: 70,374,296 (GRCm39) Y77N possibly damaging Het
Eif4g3 T C 4: 137,910,510 (GRCm39) L1330P possibly damaging Het
Eif4g3 T A 4: 137,925,408 (GRCm39) S1584T probably benign Het
Enpp1 A T 10: 24,555,146 (GRCm39) C67S probably null Het
Enpp5 C T 17: 44,392,027 (GRCm39) T152I probably damaging Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Erc2 T G 14: 27,498,838 (GRCm39) L238R probably damaging Het
Eya3 T A 4: 132,448,698 (GRCm39) probably benign Het
Farp1 T C 14: 121,476,199 (GRCm39) F339L probably damaging Het
Fsip2 A C 2: 82,805,697 (GRCm39) D672A possibly damaging Het
Gap43 G T 16: 42,112,581 (GRCm39) P60Q probably benign Het
Gpr37l1 T A 1: 135,094,783 (GRCm39) I154F probably damaging Het
Greb1 A G 12: 16,746,329 (GRCm39) S1314P probably damaging Het
Hectd4 A T 5: 121,486,505 (GRCm39) M3167L probably benign Het
Hps3 C T 3: 20,084,574 (GRCm39) probably null Het
Hps5 A G 7: 46,436,013 (GRCm39) C178R probably benign Het
Hspg2 T A 4: 137,297,384 (GRCm39) probably benign Het
Impdh2-ps A G 8: 100,757,839 (GRCm39) noncoding transcript Het
Josd2 T A 7: 44,120,678 (GRCm39) N138K probably damaging Het
Mtmr6 T G 14: 60,529,546 (GRCm39) M315R probably damaging Het
Mtrf1 G A 14: 79,650,520 (GRCm39) V323M probably damaging Het
Myo16 G T 8: 10,423,527 (GRCm39) G288W probably damaging Het
Myo18a T C 11: 77,714,149 (GRCm39) Y748H probably damaging Het
Nek1 A T 8: 61,551,545 (GRCm39) N853I probably benign Het
Npnt T G 3: 132,610,452 (GRCm39) T272P possibly damaging Het
Obi1 C T 14: 104,747,819 (GRCm39) D43N probably damaging Het
Or2ag1b C A 7: 106,288,351 (GRCm39) E196* probably null Het
Or2b6 T A 13: 21,823,340 (GRCm39) M118L possibly damaging Het
Or2y17 G A 11: 49,232,148 (GRCm39) G263D probably benign Het
Or51e1 T A 7: 102,359,378 (GRCm39) I304N probably damaging Het
Or52n2c G A 7: 104,574,017 (GRCm39) T318I possibly damaging Het
Or5a1 A G 19: 12,097,234 (GRCm39) Y269H possibly damaging Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Pappa2 T G 1: 158,784,572 (GRCm39) D146A probably damaging Het
Pcsk9 C T 4: 106,304,353 (GRCm39) G496R probably damaging Het
Pes1 A G 11: 3,914,058 (GRCm39) K8E probably damaging Het
Phlpp2 G A 8: 110,667,052 (GRCm39) G1194S probably damaging Het
Pkn1 A C 8: 84,398,378 (GRCm39) V763G probably damaging Het
Pkp2 C A 16: 16,048,588 (GRCm39) A331E probably damaging Het
Plb1 T A 5: 32,507,023 (GRCm39) probably null Het
Plxna1 A T 6: 89,309,657 (GRCm39) probably null Het
Polq C T 16: 36,862,109 (GRCm39) T264M probably damaging Het
Prkag3 T C 1: 74,779,864 (GRCm39) *490W probably null Het
Prl2c1 T C 13: 28,041,661 (GRCm39) C228R probably damaging Het
Pus7l T C 15: 94,438,591 (GRCm39) S85G probably benign Het
Rfc3 A C 5: 151,568,241 (GRCm39) probably benign Het
Riox2 A G 16: 59,309,732 (GRCm39) N362S probably benign Het
Scaper A T 9: 55,650,932 (GRCm39) D904E probably damaging Het
Scn11a T C 9: 119,583,627 (GRCm39) M1663V probably benign Het
Slc13a3 A T 2: 165,272,209 (GRCm39) I278N possibly damaging Het
Slc22a7 T C 17: 46,745,923 (GRCm39) E278G probably damaging Het
Snrnp48 T A 13: 38,393,893 (GRCm39) M66K probably damaging Het
Styk1 T G 6: 131,277,429 (GRCm39) E404A probably damaging Het
Synj1 T A 16: 90,752,307 (GRCm39) H1016L probably benign Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tjp2 T C 19: 24,097,475 (GRCm39) probably null Het
Tmem87a A G 2: 120,190,518 (GRCm39) probably null Het
Trappc9 T G 15: 72,808,909 (GRCm39) Y718S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl C T 7: 103,798,925 (GRCm39) V191M probably benign Het
Ugt2a3 C T 5: 87,475,054 (GRCm39) G397R probably damaging Het
Wdr33 T A 18: 32,019,139 (GRCm39) M454K probably benign Het
Wdtc1 G T 4: 133,029,110 (GRCm39) N325K possibly damaging Het
Whrn T C 4: 63,336,402 (GRCm39) H720R probably damaging Het
Xirp2 A T 2: 67,349,609 (GRCm39) D3268V probably damaging Het
Zc3h7a A T 16: 10,959,573 (GRCm39) H793Q probably damaging Het
Zfp518b C T 5: 38,831,841 (GRCm39) A55T possibly damaging Het
Zmynd8 G A 2: 165,647,249 (GRCm39) T901M probably damaging Het
Other mutations in Abraxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0658:Abraxas1 UTSW 5 100,965,827 (GRCm39) critical splice donor site probably null
R1591:Abraxas1 UTSW 5 100,957,505 (GRCm39) missense probably benign 0.00
R1779:Abraxas1 UTSW 5 100,965,822 (GRCm39) splice site probably benign
R2421:Abraxas1 UTSW 5 100,960,040 (GRCm39) missense possibly damaging 0.82
R2904:Abraxas1 UTSW 5 100,957,673 (GRCm39) missense probably benign 0.13
R5563:Abraxas1 UTSW 5 100,960,040 (GRCm39) missense possibly damaging 0.82
R5596:Abraxas1 UTSW 5 100,966,403 (GRCm39) missense probably damaging 1.00
R5631:Abraxas1 UTSW 5 100,965,840 (GRCm39) missense probably damaging 1.00
R5903:Abraxas1 UTSW 5 100,965,824 (GRCm39) splice site probably null
R5983:Abraxas1 UTSW 5 100,955,777 (GRCm39) missense probably benign
R7059:Abraxas1 UTSW 5 100,954,103 (GRCm39) missense probably benign 0.06
R7818:Abraxas1 UTSW 5 100,954,176 (GRCm39) missense probably benign 0.04
R7846:Abraxas1 UTSW 5 100,954,698 (GRCm39) missense probably damaging 0.99
R9333:Abraxas1 UTSW 5 100,959,939 (GRCm39) missense probably damaging 1.00
R9382:Abraxas1 UTSW 5 100,957,649 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTCTACAGCAGCCCATAC -3'
(R):5'- GGTATAAATTCCGTCGTCACTCG -3'

Sequencing Primer
(F):5'- TGCAGTAACACTTAGGTTCCAGGAC -3'
(R):5'- GTCGTCACTCGGATCAGATCATGAC -3'
Posted On 2015-11-11